SubtiBank SubtiBank
yxjF
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yxjF

sporulation protein, 3-hydroxybutyrate dehydrogenase
locus
BSU_38970
pI
7.89
mw
27.46 kDa
protein length
257 aa Sequence Blast
gene length
774 bp Sequence Blast
function
3-hydroxybutyrate utilization
product
3-hydroxybutyrate dehydrogenase
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW 4.2.1.4|Sporulation proteins/ other]
  • [category|SW 6|Groups of genes] → [category|SW 6.6|Poorly characterized/ putative enzymes]
  • Gene

    Coordinates
    4,000,539 → 4,001,312

    The protein

    Protein family

  • [SW|Short-chain dehydrogenases/reductases (SDR) family] (according to UniProt)
  • Paralogous protein(s)

  • [protein|D945CAD7209CB94A7B9E23263476124B7E8853DD|YusZ]
  • [protein|0DD474462720CAEE2AE17017BD7CA385238EBC6F|YxbG]:
  • Structure

  • [PDB|2YZ7] (from Alcaligenes Faecalis 42% identity)
  • Expression and Regulation

    Operons

    genes
    [gene|B416BB368A96926526458B2258BF8AB928D7C15E|hbuT]-[gene|A7E61C3D12BBDDD3EFD65B1EDBE280497D7B6CD0|scoA]-[gene|7F46EDA8F1EB8D9817C62D7D361FF32F9CD814AD|scoB]-[gene|B7B1D28E50244704324920E5A6F110DA8D63F6C0|yxjF]
    description
    [Pubmed|10746760]

    sigma factors

  • [protein|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE]: sigma factor, [Pubmed|12662922], in [regulon|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE regulon]
  • regulatory mechanism

  • [protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA]: repression, [Pubmed|12850135,10666464], in [regulon|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA regulon]
  • regulation

  • expressed early during sporulation in the mother cell ([protein|search|SigE]) [Pubmed|12662922]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-B730 (yxjF::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1729 NBRP B. subtilis, Japan]
  • GP1112 (spc), available in [SW|Stülke] lab
  • BKE38970 (Δ[gene|B7B1D28E50244704324920E5A6F110DA8D63F6C0|yxjF]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE38970 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTCAAACACCTTCCCAT, downstream forward: _UP4_TGACATAAAAAACACACTTG
  • BKK38970 (Δ[gene|B7B1D28E50244704324920E5A6F110DA8D63F6C0|yxjF]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK38970 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTCAAACACCTTCCCAT, downstream forward: _UP4_TGACATAAAAAACACACTTG
  • References

  • 16672620,10666464,12850135,10746760,12662922