SubtiBank SubtiBank
hprT
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

hprT

trigger enzyme, hypoxanthine phosphoribosyltransferase and part of a transcription activator
locus
BSU_00680
pI
4.60
mw
20.10 kDa
protein length
180 aa Sequence Blast
gene length
543 bp Sequence Blast
function
purine salvage and interconversion, control of [gene|4E7B9426CED372AA8A321A147116A3A589FBF20C|ftsH] expression
product
hypoxanthine phosphoribosyltransferase
essential
no
ec
2.4.2.8
synonyms

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.5|Nucleotide metabolism] → [category|SW 2.5.2|Biosynthesis/ acquisition of nucleotides] → [category|SW 2.5.2.3|Purine salvage and interconversion]
  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW 3.4.2.5|Transcription factors/ other]
  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW 3.4.2.7|Control of transcription factor (other than two-component system)]
  • [category|SW 3|Information processing] → [category|SW 3.5|Targets of second messengers] → [category|SW 3.5.3|Targets of (p)ppGpp]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.2|Cell envelope stress proteins (controlled by SigM, V, W, X, Y)]
  • Gene

    Coordinates
    76,344 → 76,886

    Phenotypes of a mutant

  • essential [Pubmed|12682299], non-essential according to [Pubmed|28189581]
  • The protein

    Catalyzed reaction/ biological activity

  • diphosphate + IMP --> 5-phospho-α-D-ribose 1-diphosphate + hypoxanthine (according to UniProt)
  • diphosphate + GMP --> 5-phospho-α-D-ribose 1-diphosphate + guanine (according to UniProt)
  • Protein family

  • [SW|Purine/pyrimidine phosphoribosyltransferase family] (according to UniProt)
  • Kinetic information

  • KM (PRPP): 166 µM [pubmed|31552824]
  • KI (pppGpp): 1.7 µM [pubmed|31552824]
  • Effectors of protein activity

  • inhibition of enzymatic activity by (p)ppGpp during the ´stringent response´, (p)ppGpp binds to the acive site of the enzyme and prevents the conversion of the apo-tetramer to the active dimer [Pubmed|31552824,22981860]
  • Structure

  • [PDB|6D9Q] (apo-protein) [pubmed|31552824]
  • [PDB|6D9R] (complex with the substrate PRPP) [pubmed|31552824]
  • [PDB|6D9S] (complex with ppGpp) [pubmed|31552824]
  • [SW|Localization]

  • cytoplasm (according to UniProt)
  • Expression and Regulation

    Operons

    genes
    [gene|473F93EA5ADB78CD23C9C054B5D6B739078DDEEB|tilS]-[gene|B7BFC170EEC88DEC6CF932F80805D3F2C0BD3738|hprT]-[gene|4E7B9426CED372AA8A321A147116A3A589FBF20C|ftsH]
    description
    [Pubmed|18179421]

    sigma factors

  • [protein|081DF3EE9FA56209D648C7677188C61CE3AA8E41|SigM]: sigma factor, [Pubmed|18179421], in [regulon|081DF3EE9FA56209D648C7677188C61CE3AA8E41|SigM regulon]
  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|7608085], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|473F93EA5ADB78CD23C9C054B5D6B739078DDEEB|TilS]: activation, with [protein|B7BFC170EEC88DEC6CF932F80805D3F2C0BD3738|HprT] [Pubmed|24001521], in [regulon|473F93EA5ADB78CD23C9C054B5D6B739078DDEEB|TilS regulon]
  • [protein|B7BFC170EEC88DEC6CF932F80805D3F2C0BD3738|HprT]: activation, with [protein|473F93EA5ADB78CD23C9C054B5D6B739078DDEEB|TilS] [Pubmed|24001521], in [regulon|B7BFC170EEC88DEC6CF932F80805D3F2C0BD3738|HprT regulon]
  • regulation

  • induced by heat shock (class III)
  • additional information

  • the mRNA is very stable (half-life > 15 min) [http://www.ncbi.nlm.nih.gov/sites/entrez/12884008 PubMed]
  • view in new tab

    genes
    [gene|7C8DFE00A2B2B30CC8BEB35055D92CC2E4128F3A|spoIIE]-[gene|C8AA53889FC8B389E1D921B762BD78990C7A8E57|yabS]-[gene|E86A96B832351FF513DD9853EAD8998CC44C9951|yabT]-[gene|473F93EA5ADB78CD23C9C054B5D6B739078DDEEB|tilS]-[gene|B7BFC170EEC88DEC6CF932F80805D3F2C0BD3738|hprT]-[gene|4E7B9426CED372AA8A321A147116A3A589FBF20C|ftsH]
    description
    [pubmed|22383849]

    sigma factors

  • [protein|CFF318EE6CACDEE763FBF96A2ABB46E944679AAA|SigF]: sigma factor, [Pubmed|16497325], in [regulon|CFF318EE6CACDEE763FBF96A2ABB46E944679AAA|SigF regulon]
  • regulation

  • expressed early during sporulation in the forespore ([protein|CFF318EE6CACDEE763FBF96A2ABB46E944679AAA|SigF]) [Pubmed|16497325]
  • view in new tab

    Biological materials

    Mutant

  • BKE00680 (Δ[gene|B7BFC170EEC88DEC6CF932F80805D3F2C0BD3738|hprT]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE00680 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCATGATTTTGCTTGCCC, downstream forward: _UP4_TGATCGGCAGCCTGCTTCCG
  • BKK00680 (Δ[gene|B7BFC170EEC88DEC6CF932F80805D3F2C0BD3738|hprT]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK00680 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCATGATTTTGCTTGCCC, downstream forward: _UP4_TGATCGGCAGCCTGCTTCCG
  • References

    Reviews

  • 28031352
  • Original publications

  • 18179421,22981860,24001521,6408059,28189581,31552824