SubtiBank SubtiBank
pamR
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.

pamR

[SW|MarR family|MarR/DUF24 family] transcription factor
locus
BSU_04770
pI
9.36
mw
16.49 kDa
protein length
147 aa Sequence Blast
gene length
444 bp Sequence Blast
function
control of the [gene|20D50DA11B864E6C719CC34BE27C7900893EA054|ydcF]-[gene|89AB146F447696EF1CBE219C9A2FB5CBB380F847|ydcG]-[gene|search|pamR ]operon
product
[SW|MarR family|MarR/DUF24 family] transcription factor
essential
no
synonyms
ydcH

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW 3.4.2.5|Transcription factors/ other]
  • Gene

    Coordinates
    525,206 → 525,649

    The protein

    Protein family

  • [SW|MarR family|MarR/DUF24 family]
  • [SW|Domains]

  • [SW|HTH marR-type domain] (aa 11-147) (according to UniProt)
  • Structure

  • [PDB|3BPX] ([protein|search|MarR ]from Methanothermobacter thermautotrophicus, 28% identity, aa 29 - 137) [pubmed|18272181]
  • Expression and Regulation

    Operons

    genes
    [gene|20D50DA11B864E6C719CC34BE27C7900893EA054|ydcF]-[gene|89AB146F447696EF1CBE219C9A2FB5CBB380F847|ydcG]-[gene|B7F5FA5C656D39970959BC857E93B78B1A063098|pamR]
    description
    [pubmed|29240826,22383849]

    regulatory mechanism

  • [protein|B7F5FA5C656D39970959BC857E93B78B1A063098|PamR]: repression, [pubmed|29240826], in [regulon|B7F5FA5C656D39970959BC857E93B78B1A063098|PamR regulon]
  • view in new tab

    genes
    [gene|89AB146F447696EF1CBE219C9A2FB5CBB380F847|ydcG]-[gene|B7F5FA5C656D39970959BC857E93B78B1A063098|pamR]
    description
    [pubmed|22383849]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [pubmed|22383849], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-C096 (ydcH::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2094 NBRP B. subtilis, Japan]
  • BKE04770 (Δ[gene|B7F5FA5C656D39970959BC857E93B78B1A063098|pamR]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE04770 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CGGGCTTGTGTTCGGACCGC, downstream forward: _UP4_TAAAGATACGGGCAGCGCCA
  • BKK04770 (Δ[gene|B7F5FA5C656D39970959BC857E93B78B1A063098|pamR]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK04770 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CGGGCTTGTGTTCGGACCGC, downstream forward: _UP4_TAAAGATACGGGCAGCGCCA
  • References

    Research papers

  • 29240826,18272181