SubtiBank SubtiBank
ykvT
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.

ykvT

similar to spore cortex-lytic enzyme, putative cell wall hydrolase
locus
BSU_13820
pI
9.79
mw
23.33 kDa
protein length
208 aa Sequence Blast
gene length
627 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 1|Cellular processes] → [category|SW 1.1|Cell envelope and cell division] → [category|SW 1.1.3|Cell wall degradation/ turnover] → [category|SW 1.1.3.2|Autolysis/ based on similarity]
  • Gene

    Coordinates
    1,448,506 → 1,449,132

    The protein

    Structure

  • [PDB|4FET] (from B. anthracis, corresponds to aa 70 ... 207, 35% identity) [pubmed|22777830]
  • Expression and Regulation

    Operons

    genes
    [gene|9949D9A6E04389D08AE8F874DA5019994C06AF88|ykzS]-[gene|B81F1F1ED944D9F2A72BD736E145AD12BB54A7C3|ykvT]
    description
    [Pubmed|22383849]

    regulatory mechanism

  • [protein|7F340423A34CE40D1F1AA8D373F7C4B859A6496D|WalR]: activation, [Pubmed|12950927], in [regulon|7F340423A34CE40D1F1AA8D373F7C4B859A6496D|WalR regulon]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-A054 (ykvT::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/54 NBRP B. subtilis, Japan]
  • BKE13820 (Δ[gene|B81F1F1ED944D9F2A72BD736E145AD12BB54A7C3|ykvT]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE13820 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATACAGTTTCCTCCTTAAA, downstream forward: _UP4_TAAGCATAGAAGAGACAATT
  • BKK13820 (Δ[gene|B81F1F1ED944D9F2A72BD736E145AD12BB54A7C3|ykvT]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK13820 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATACAGTTTCCTCCTTAAA, downstream forward: _UP4_TAAGCATAGAAGAGACAATT
  • References

  • 12950927,23199363,22777830