SubtiBank SubtiBank
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.


similar to transcription factor (AraC family)
89.36 kDa
protein length
772 aa Sequence Blast
gene length
2319 bp Sequence Blast

Genomic Context



  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW|Transcription factor/ other/ based on similarity]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    3,083,441 → 3,085,759

    The protein

    Protein family

  • [SW|AraC family]
  • [SW|Localization]

  • cell membrane (according to UniProt)
  • Expression and Regulation


    view in new tab

    Biological materials


  • MGNA-A808 (ytdP::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE30150 (Δ[gene|B83FEAA1EB9F1B2BD9AA27D0B86DFC4A4B952A40|rmgR]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTCATAACATCCACTTC, downstream forward: _UP4_TAAAAAACCCAAAACCGCTT
  • BKK30150 (Δ[gene|B83FEAA1EB9F1B2BD9AA27D0B86DFC4A4B952A40|rmgR]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTCATAACATCCACTTC, downstream forward: _UP4_TAAAAAACCCAAAACCGCTT
  • References

  • 21630458,23504016