SubtiBank SubtiBank
rnhC
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

rnhC

RNase HIII, endoribonuclease
locus
BSU_28620
pI
10.07
mw
33.92 kDa
protein length
313 aa Sequence Blast
gene length
939 bp Sequence Blast
function
endonucleolytic cleavage of RNA in RNA-DNA hybrid molecules, processing of R-loops, maturation of Okazaki fragments
product
Mn2+-dependent RNase HIII
essential
no
ec
3.1.26.4
synonyms
ysgB

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.1|Genetics] → [category|SW 3.1.1|DNA replication]
  • [category|SW 3|Information processing] → [category|SW 3.2|RNA synthesis and degradation] → [category|SW 3.2.4|RNases] → [category|SW 3.2.4.2|Endoribonucleases]
  • Gene

    Coordinates
    2,926,031 → 2,926,972

    Phenotypes of a mutant

  • cold-sensisitive due to a defect in Okazaki fragment maturation [pubmed|30670546]
  • a [gene|B8B0F6B129475FDEEA8D538A51C153BF9A35887D|rnhC] [gene|3D6DA8B52A4CB49361E67906140696FFA1EF6099|polA] double mutant is not viable at 25°C [pubmed|30670546]
  • a [gene|B8B0F6B129475FDEEA8D538A51C153BF9A35887D|rnhC] [gene|FCDE5EA6E50A8C72A499E2F1FFB808DC86466A29|exoR] double mutant is not viable at 25°C [pubmed|30670546]
  • sensitive to hydroxyurea [pubmed|29084857]
  • a ''[gene|D5275ECDC2A70FBAC2CA5980F04B272C3328FC90|rnhB] [gene|B8B0F6B129475FDEEA8D538A51C153BF9A35887D|rnhC]'' double mutant grows poorly [Pubmed|23882084]
  • The protein

    Catalyzed reaction/ biological activity

  • maturation of Okazaki fragments (removal of RNA) (together with [protein|3D6DA8B52A4CB49361E67906140696FFA1EF6099|DNA polymerase I]) [pubmed|30670546]
  • Endonucleolytic cleavage to 5'-phosphomonoester (according to UniProt)
  • Protein family

  • [SW|RNase] HII family (with [protein|D5275ECDC2A70FBAC2CA5980F04B272C3328FC90|RnhB], according to UniProt)
  • [SW|Cofactors]

  • Mn2+ [pubmed|29084857]
  • Structure

  • [PDB|2D0B] (complex with Mg2+, Geobacillus stearothermophilus , 47% identity) [pubmed|16343535]
  • [PDB|2D0A] (Geobacillus stearothermophilus, 47% identity) [pubmed|16343535]
  • [SW|Localization]

  • cytoplasm (according to Swiss-Prot)
  • additional information

  • [protein|B8B0F6B129475FDEEA8D538A51C153BF9A35887D|RnhC] may interact with [SW|RNA polymerase] [pubmed|21710567]
  • Expression and Regulation

    Operons

    genes
    [gene|B8B0F6B129475FDEEA8D538A51C153BF9A35887D|rnhC]
    description
    [Pubmed|8969504]
    view in new tab

    Biological materials

    Mutant

  • MGNA-B002 (ysgB::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1001 NBRP B. subtilis, Japan]
  • BP430 (''ΔrnhC::cat'') available in [SW|Fabian Commichau]'s lab
  • BKE28620 (Δ[gene|B8B0F6B129475FDEEA8D538A51C153BF9A35887D|rnhC]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE28620 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACGTAATAATCTCCTTTTT, downstream forward: _UP4_TAGAAAAAAGCTTGCAGATT
  • BKK28620 (Δ[gene|B8B0F6B129475FDEEA8D538A51C153BF9A35887D|rnhC]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK28620 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACGTAATAATCTCCTTTTT, downstream forward: _UP4_TAGAAAAAAGCTTGCAGATT
  • Expression vectors

  • for expression/ purification from ''B. subtilis'' with C-terminal Strep-tag, for [SW|SPINE], expression from plasmid: pBP502 (E. coli amp & B. subtilis E/L) , available in [SW|Fabian Commichau]'s lab
  • References

    Reviews

  • 19228197,24464998,29856930,31464530
  • Original publications

  • 8969504,10094689,9888800,17905985,23882084,21710567,16343535,21710567,28802046,29084857,30670546