SubtiBank SubtiBank
rnhC
The papers of the month are back! Check them out! Link here

rnhC

RNase HIII, endoribonuclease
locus
BSU28620
pI
10.07
mw
33.92 kDa
protein length
313 aa Sequence Blast
gene length
939 bp Sequence Blast
function
endonucleolytic cleavage of RNA in RNA-DNA hybrid molecules, processing of R-loops
product
Mn2+-dependent RNase HIII
essential
no
ec
3.1.26.4
synonyms
ysgB

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.2|RNA synthesis and degradation] → [category|SW 3.2.4|RNases] → [category|SW 3.2.4.2|Endoribonucleases]
  • Gene

    Coordinates
    2,926,031 → 2,926,972

    Phenotypes of a mutant

  • snesitive to hydroxyurea [pubmed|29084857]
  • a ''[gene|D5275ECDC2A70FBAC2CA5980F04B272C3328FC90|rnhB] [gene|B8B0F6B129475FDEEA8D538A51C153BF9A35887D|rnhC]'' double mutant grows poorly [Pubmed|23882084]
  • The protein

    Catalyzed reaction/ biological activity

  • Endonucleolytic cleavage of RNA to 5'-phosphomonoester (according to Swiss-Prot)
  • Protein family

  • RnhC subfamily (according to Swiss-Prot)
  • [SW|Cofactors]

  • Mn2+ [pubmed|29084857]
  • Structure

  • [PDB|2D0B] (complex with Mg2+, Geobacillus stearothermophilus , 47% identity) [pubmed|16343535]
  • [PDB|2D0A] (Geobacillus stearothermophilus, 47% identity) [pubmed|16343535]
  • [SW|Localization]

  • cytoplasm (according to Swiss-Prot)
  • additional information

  • [protein|B8B0F6B129475FDEEA8D538A51C153BF9A35887D|RnhC] may interact with [SW|RNA polymerase] [pubmed|21710567]
  • Expression and Regulation

    Operons

    genes
    [gene|B8B0F6B129475FDEEA8D538A51C153BF9A35887D|rnhC]
    description
    [Pubmed|8969504]
    view in new tab

    Biological materials

    Mutant

  • MGNA-B002 (ysgB::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1001 NBRP B. subtilis, Japan]
  • BP430 (''ΔrnhC::cat'') available in [SW|Fabian Commichau]'s lab
  • BKE28620 (Δ[gene|B8B0F6B129475FDEEA8D538A51C153BF9A35887D|rnhC]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE28620 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACGTAATAATCTCCTTTTT, downstream forward: _UP4_TAGAAAAAAGCTTGCAGATT
  • BKK28620 (Δ[gene|B8B0F6B129475FDEEA8D538A51C153BF9A35887D|rnhC]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK28620 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACGTAATAATCTCCTTTTT, downstream forward: _UP4_TAGAAAAAAGCTTGCAGATT
  • Expression vector

  • for expression/ purification from ''B. subtilis'' with C-terminal Strep-tag, for [SW|SPINE], expression from plasmid: pBP502 (E. coli amp & B. subtilis E/L) , available in [SW|Fabian Commichau]'s lab
  • References

    Reviews

  • 19228197,24464998
  • Original publications

  • 8969504,10094689,9888800,17905985,23882084,21710567,16343535,21710567,28802046,29084857