SubtiBank SubtiBank
gbsB
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

gbsB

choline dehydrogenase (FAD-dependent), glycine betaine synthesis
locus
BSU_31050
pI
4.91
mw
43.39 kDa
protein length
403 aa Sequence Blast
gene length
1209 bp Sequence Blast
function
osmoprotection
product
choline dehydrogenase (FAD-dependent)
essential
no
ec
1.1.1.1
synonyms

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.6|Additional metabolic pathways] → [category|SW 2.6.6|Miscellaneous metabolic pathways] → [category|SW 2.6.6.4|Biosynthesis of glycine betaine]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.6|Coping with hyper-osmotic stress]
  • Gene

    Coordinates
    3,183,867 → 3,185,075

    The protein

    Catalyzed reaction/ biological activity

  • choline + NAD+ --> betaine aldehyde + H+ + NADH (according to UniProt)
  • Protein family

  • iron-containing alcohol dehydrogenase family (with [protein|1E951C2B640966643D5F081159522CD1C51942C8|YugJ] and [protein|D81610C7CA2A92FCB1195591ACB613E7C1288F6B|YugK], according to UniProt)
  • [SW|Cofactors]

  • FAD
  • Structure

  • [PDB|3BFJ] (from Klebsiella pneumoniae, 39% identity) [pubmed|19011020]
  • Expression and Regulation

    Operons

    genes
    [gene|1ADC55F8E265AF86E29743C671CE1EA1BE7EB41E|gbsA]-[gene|B90D4E798145F2AF3421DDC5AB6CD578E2E17900|gbsB]
    description
    [Pubmed|8752328]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|8752328], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|5C398C1181CE25CAC079AFBA5871C0B72AE1AA96|GbsR]: repression, (transcriptional roadblock) [Pubmed|32849357,22408163], in [regulon|5C398C1181CE25CAC079AFBA5871C0B72AE1AA96|GbsR regulon]
  • regulation

  • induced by choline ([protein|5C398C1181CE25CAC079AFBA5871C0B72AE1AA96|GbsR]) [Pubmed|22408163,8752328]
  • view in new tab

    Biological materials

    Mutant

  • 1A1056 ( ''gbsB''::''kan''), [Pubmed|21296969], available at [http://pasture.asc.ohio-state.edu/BGSC/getdetail.cfm?bgscid=1A1056&Search=1A1056 BGSC]
  • BKE31050 (Δ[gene|B90D4E798145F2AF3421DDC5AB6CD578E2E17900|gbsB]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE31050 BGSC], [Pubmed|28189581], upstream reverse: _UP1_TAATGTCATCATCAATCTCC, downstream forward: _UP4_TAATCAAAATCCCGCTCCTT
  • BKK31050 (Δ[gene|B90D4E798145F2AF3421DDC5AB6CD578E2E17900|gbsB]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK31050 BGSC], [Pubmed|28189581], upstream reverse: _UP1_TAATGTCATCATCAATCTCC, downstream forward: _UP4_TAATCAAAATCCCGCTCCTT
  • labs

  • [SW|Erhard Bremer], University of Marburg, Germany [http://www.uni-marburg.de/fb17/fachgebiete/mikrobio/molmibi homepage]
  • References

  • 8752328,21296969,22408163,29159878,19011020