SubtiBank SubtiBank
hemAT
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.

hemAT

soluble chemotaxis receptor, heme-containing O2 sensor protein
locus
BSU_10380
pI
5.44
mw
48.60 kDa
protein length
432 aa Sequence Blast
gene length
1299 bp Sequence Blast
function
movement towards oxygen
product
haem-based aerotactic transducer
essential
no
synonyms
yhfV

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.1|Exponential and early post-exponential lifestyles] → [category|SW 4.1.1|Motility and chemotaxis] → [category|SW 4.1.1.1|Signal transduction in motility and chemotaxis] → [category|SW 4.1.1.1.3|Soluble chemoreceptors]
  • [category|SW 4|Lifestyles] → [category|SW 4.1|Exponential and early post-exponential lifestyles] → [category|SW 4.1.2|Biofilm formation] → [category|SW 4.1.2.6|Other proteins required for efficient pellicle biofilm formation]
  • Gene

    Coordinates
    1,112,620 → 1,113,918

    Phenotypes of a mutant

  • not essential for pellicle biofilm formation, but mutant is outcompeted by the wild-type strain when competed during pellicle formation [Pubmed|26122431]
  • NCIB3610 ''hemAT'' mutant has higher fitness than ''[gene|E0BB77C8F1220E931D16A1FA6B75AE8907C76FDB|hag]'' mutant during pellicle formation [Pubmed|26122431]
  • NCIB3610 ''hemAT''-''[gene|E0BB77C8F1220E931D16A1FA6B75AE8907C76FDB|hag]'' double mutant has similar fitness to single ''[gene|E0BB77C8F1220E931D16A1FA6B75AE8907C76FDB|hag]'' mutant during pellicle formation [Pubmed|26122431]
  • The protein

    Catalyzed reaction/ biological activity

  • required for full expression of the ''[gene|597771E2E8EC31ED9B2CC8C0E4D888DEEA80F689|phoD]-[gene|E4395255CD43ACB611E0BA872182DF801662C366|tatAD]-[gene|A58C9B9BB6574662A44AF0C7A94DFFE368B740E2|tatCD]'' operon [Pubmed|23180473]
  • [SW|Domains]

  • [SW|Methyl-accepting transducer domain] (aa 184-420) (according to UniProt)
  • [SW|Cofactors]

  • heme
  • Structure

  • [PDB|1OR4] (in cyano-liganded form), [PDB|1OR6] [Pubmed|12962628]
  • [SW|Localization]

  • forms clusters at the cell poles [Pubmed|21515776]
  • homogeneous cytoplasmic distribution in chain-forming cells during the logarithmic phase [Pubmed|23180473]
  • polar foci in individual cells at later growth stages [Pubmed|23180473]
  • Expression and Regulation

    Operons

    genes
    [gene|B948B9D96CDC43A07B3FF90212E52230A0EF1905|hemAT]
    description
    [Pubmed|15033535]

    sigma factors

  • [protein|7024E4162A6D827069F882FDEACA696EBC05DD40|SigD]: sigma factor, [Pubmed|15033535], in [regulon|7024E4162A6D827069F882FDEACA696EBC05DD40|SigD regulon]
  • additional information

  • in minimal medium, HemAT is present with 19,000 +/- 3,900 molecules per cell [PubMed|21515776]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-B282 (yhfV::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1281 NBRP B. subtilis, Japan]
  • TB239 (''hemAT''::''neo'' in 168) [Pubmed|26122431]
  • TB241 (''hemAT''::''neo'' in NCIB3610) [Pubmed|26122431]
  • BKE10380 (Δ[gene|B948B9D96CDC43A07B3FF90212E52230A0EF1905|hemAT]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE10380 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAATACAATGATCCCCCTTG, downstream forward: _UP4_TAACCATCAAAAACCGGTCT
  • BKK10380 (Δ[gene|B948B9D96CDC43A07B3FF90212E52230A0EF1905|hemAT]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK10380 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAATACAATGATCCCCCTTG, downstream forward: _UP4_TAACCATCAAAAACCGGTCT
  • labs

  • [SW|Akos T Kovacs]
  • References

    Reviews

  • 23928310
  • Original publications

  • 26122431,10676961,16819829,11481493,15033535,21515776,23180473,22564695,28725484