SubtiBank SubtiBank
rlmCD
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

rlmCD

rRNA methyltransferase
locus
BSU_06730
pI
5.71
mw
51.65 kDa
protein length
459 aa Sequence Blast
gene length
1380 bp Sequence Blast
function
23S rRNA maturation
product
rRNA methyltransferase
essential
no
ec
2.1.1.190
synonyms
yerS,yefA

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.3|Protein synthesis, modification and degradation] → [category|SW 3.3.1|Translation] → [category|SW 3.3.1.2|rRNA modification and maturation]
  • Gene

    Coordinates
    737,603 → 738,982

    The protein

    Catalyzed reaction/ biological activity

  • methylation of U747 and U1939 in 23S rRNA [Pubmed|21824914]
  • S-adenosyl-L-methionine + uridine747 in 23S rRNA --> 5-methyluridine747 in 23S rRNA + H+ + S-adenosyl-L-homocysteine (according to UniProt)
  • S-adenosyl-L-methionine + uridine1939 in 23S rRNA --> 5-methyluridine1939 in 23S rRNA + H+ + S-adenosyl-L-homocysteine (according to UniProt)
  • Protein family

  • [SW|Methyltransferase superfamily] (according to UniProt)
  • [SW|class I-like SAM-binding methyltransferase superfamily] (according to UniProt)
  • Paralogous protein(s)

  • [protein|05392BB2C32B0405799D4F34E5BA55FC936AB943|YfjO]
  • [SW|Domains]

  • [SW|TRAM domain] (aa 6-64) (according to UniProt)
  • [SW|Cofactors]

  • Fe-S cluster [pubmed|29292548]
  • Structure

  • [PDB|2BH2] (from ''E. coli'', 32% identity) [Pubmed|15766524]
  • Expression and Regulation

    Operons

    genes
    [gene|943294ACA74067A8549056699E08DF5B82337976|dgkB]-[gene|B97ABE3233A27A7C8273ED9A1E688247DD37FD12|rlmCD]
    description
    [Pubmed|22383849]
    view in new tab

    genes
    [gene|943294ACA74067A8549056699E08DF5B82337976|dgkB]-[gene|B97ABE3233A27A7C8273ED9A1E688247DD37FD12|rlmCD]-[gene|5B5014A68D777DB79179904D5FD3D14DEE0BF1F4|yefC]-[gene|D3F00747006D974A8635D4391E0C261A3276E6AB|yeeA]-[gene|2E55D086DD5023B98929FB8B61238C00E66B8BCB|yeeB]-[gene|DB1AAC91947A6008F631266E5CC85B58703AFD9D|yeeC]
    description
    [Pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • MGNA-A931 (yefA::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/931 NBRP B. subtilis, Japan]
  • BKE06730 (Δ[gene|B97ABE3233A27A7C8273ED9A1E688247DD37FD12|rlmCD]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE06730 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCTATAATCACCTCTAGT, downstream forward: _UP4_TTAAAAGAATAAATAGTCAA
  • BKK06730 (Δ[gene|B97ABE3233A27A7C8273ED9A1E688247DD37FD12|rlmCD]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK06730 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCTATAATCACCTCTAGT, downstream forward: _UP4_TTAAAAGAATAAATAGTCAA
  • References

  • 21824914,15766524