SubtiBank SubtiBank
yvlD
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

yvlD

unknown
locus
BSU_35100
pI
8.80
mw
12.76 kDa
protein length
119 aa Sequence Blast
gene length
360 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.2|Cell envelope stress proteins (controlled by SigM, V, W, X, Y)]
  • Gene

    Coordinates
    3,606,762 → 3,607,121

    Phenotypes of a mutant

  • a ''yvlD'' point mutation has been isolated upon selction at low pressure [Pubmed|26296725]
  • Expression and Regulation

    Operons

    genes
    [gene|C036C00DA07E25F103E65D12C652C12A5DC0B68C|yvlA]-[gene|1443F7E8B8DDA6BDDEFF07E21E64F9D574E0FB1B|yvlB]-[gene|C6976A38AC0631BD5DF1C294DA7497C76D63193C|yvlC]-[gene|B9911180282A2C3DEDEE74CB556F025AF0F26C4E|yvlD]
    description
    [Pubmed|9987136]

    sigma factors

  • [protein|3D974DD2967C7F8FD4E3C2AF42617B8AE9F0296D|SigW]: sigma factor, [Pubmed|9987136,12207695], in [regulon|3D974DD2967C7F8FD4E3C2AF42617B8AE9F0296D|SigW regulon]
  • regulation

  • induced by cell wall stress ([protein|search|SigW]) [Pubmed|9987136,12207695]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-A384 (yvlD::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/384 NBRP B. subtilis, Japan]
  • BKE35100 (Δ[gene|B9911180282A2C3DEDEE74CB556F025AF0F26C4E|yvlD]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE35100 BGSC], [Pubmed|28189581], upstream reverse: _UP1_AATGCTGACTGCCCATTTTA, downstream forward: _UP4_TAAAAAAAGCTGCCCGCAAA
  • BKK35100 (Δ[gene|B9911180282A2C3DEDEE74CB556F025AF0F26C4E|yvlD]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK35100 BGSC], [Pubmed|28189581], upstream reverse: _UP1_AATGCTGACTGCCCATTTTA, downstream forward: _UP4_TAAAAAAAGCTGCCCGCAAA
  • References

  • 12076816,9987136,12207695,220817675,26296725