SubtiBank SubtiBank
yngJ
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.

yngJ

3-methylbutanoyl-CoA dehydrogenase
locus
BSU_18260
pI
5.79
mw
40.76 kDa
protein length
380 aa Sequence Blast
gene length
1143 bp Sequence Blast
function
mother cell metabolism, leucine utilization
product
3-methylbutanoyl-CoA dehydrogenase
essential
no
ec
1.3.99.10
synonyms

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.3|Amino acid/ nitrogen metabolism] → [category|SW 2.3.2|Utilization of amino acids] → [category|SW 2.3.2.9|Utilization of branched-chain amino acids]
  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW 4.2.1.4|Sporulation proteins/ other]
  • Gene

    Coordinates
    1,956,218 → 1,957,360

    The protein

    Catalyzed reaction/ biological activity

  • 3-methylbutanoyl-CoA -→ 3-methylbut-2-enoyl-CoA [Pubmed|19935659]
  • A + 2,3-saturated acyl-CoA --> 2,3-dehydroacyl-CoA + AH2 (according to UniProt)
  • Protein family

  • [SW|Acyl-CoA dehydrogenase family] (according to UniProt)
  • Paralogous protein(s)

  • [protein|F25CDDEBAFC72036664323619F5197D45E86BE9A|MmgC], [protein|7D89BBB52403BF99416250688EFA90C2BE8EB591|AcdA], [protein|B5325CBF1408E2CA227EB462092E209F4C87E797|FadE]
  • [SW|Cofactors]

  • FAD (according to UniProt)
  • Structure

  • [PDB|3OWA] (from ''B. anthracis'', 37% identity, 54% similarity)
  • Expression and Regulation

    Operons

    genes
    [gene|BA28DFBAF88A4994B0541D1FF2187312FDE1FA15|yngJ]-[gene|5F73ACDEAFC7F1EB26D55195100C3283FC1F587C|yngI]-[gene|CAF58B4BAEB03353CF80A2862590888D07B48E2C|yngH]-[gene|1FBF1512C28BCE04E7D51247D94DC88C72FBFF07|yngHB]-[gene|EEEE69A98DFAA3327FBC04F1422E959D8B44AF20|yngG]-[gene|D5CCFDE9312909B7E5B98876794569357791C76B|yngF]-[gene|2192474E13EAF6D2CF97CB957864FC89ED0118E0|yngE]
    description
    [Pubmed|12662922]

    sigma factors

  • [protein|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE]: sigma factor, [Pubmed|15699190,12662922], in [regulon|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE regulon]
  • regulation

  • expressed during sporulation in the mother cell ([protein|search|SigE]) [Pubmed|15699190,12662922]
  • view in new tab

    Biological materials

    Mutant

  • BKE18260 (Δ[gene|BA28DFBAF88A4994B0541D1FF2187312FDE1FA15|yngJ]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE18260 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACATCGTTTCCTCCTTCAC, downstream forward: _UP4_TAAAAATGTAAACGCTTTCC
  • BKK18260 (Δ[gene|BA28DFBAF88A4994B0541D1FF2187312FDE1FA15|yngJ]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK18260 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACATCGTTTCCTCCTTCAC, downstream forward: _UP4_TAAAAATGTAAACGCTTTCC
  • References

  • 15699190,12662922,19935659