SubtiBank SubtiBank
ywdJ
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

ywdJ

unknown
locus
BSU_37940
pI
10.02
mw
49.81 kDa
protein length
440 aa Sequence Blast
gene length
1323 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms
ipa-60d

Genomic Context

      

categories

  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    3,894,463 → 3,895,785

    The protein

    Protein family

  • [SW|xanthine/uracil permease family] (according to UniProt)
  • [SW|Nucleobase:cation symporter-2 (NCS2) (TC 2.A.40) subfamily] (according to UniProt)
  • [SW|Localization]

  • cell membrane (according to UniProt)
  • Expression and Regulation

    Operons

    genes
    [gene|F267C75289D19D039F6E97F5DABCDFF0B4E4B8FA|ywdI]-[gene|BA4D8EF5B09345E94EEEEB936C803B71340DC5EE|ywdJ]-[gene|386D4F640E987E3752BEBE57BF25DF487D12EFCE|ywdK]
    description
    [Pubmed|12823818]

    regulatory mechanism

  • [protein|857EF1AC54DEA0690C01B7F8CEFFD16312C58F20|TnrA]: repression, [Pubmed|12823818], in [regulon|857EF1AC54DEA0690C01B7F8CEFFD16312C58F20|TnrA regulon]
  • regulation

  • repressed in the absence of good nitrogen sources (glutamine or ammonium) ([protein|search|TnrA]) [Pubmed|12823818]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-A565 (ywdJ::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/565 NBRP B. subtilis, Japan]
  • BKE37940 (Δ[gene|BA4D8EF5B09345E94EEEEB936C803B71340DC5EE|ywdJ]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE37940 BGSC], [Pubmed|28189581], upstream reverse: _UP1_TTTCACGTAAGCTCAACCTC, downstream forward: _UP4_TGAATTTTGGTGCAGGTGCG
  • BKK37940 (Δ[gene|BA4D8EF5B09345E94EEEEB936C803B71340DC5EE|ywdJ]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK37940 BGSC], [Pubmed|28189581], upstream reverse: _UP1_TTTCACGTAAGCTCAACCTC, downstream forward: _UP4_TGAATTTTGGTGCAGGTGCG
  • References

  • 12823818,25755103