SubtiBank SubtiBank
ycbH
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

ycbH

galactarate dehydratase
locus
BSU_02510
pI
5.70
mw
54.63 kDa
protein length
510 aa Sequence Blast
gene length
1533 bp Sequence Blast
function
galactarate utilization
product
galactarate dehydratase
essential
no
ec
4.2.1.42
synonyms
garD

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.2|Carbon metabolism] → [category|SW 2.2.2|Utilization of specific carbon sources] → [category|SW 2.2.2.14|Utilization of glucarate/galactarate]
  • Gene

    Coordinates
    274,029 → 275,561

    The protein

    Catalyzed reaction/ biological activity

  • galactarate --> 5-dehydro-4-deoxy-D-glucarate + H2O (according to UniProt)
  • Protein family

  • uxaA family (with [protein|ED29D2DE48AADEA09C90F08B6021555C357946B4|UxaA], according to UniProt)
  • Expression and Regulation

    Operons

    genes
    [gene|3542BC20C11985B3CFAA4F930E8D794700ADFD2E|ycbC]-[gene|5B66ADB81AB141982F187B1C5E3A9346AA064DE2|ycbD]-[gene|9C4932DA4DEF99263E57871A99684E3DAD93E1EC|ycbE]-[gene|372F2A420309DB0193AEF36A740EBA26410F97F2|ycbF]-[gene|1A65880F68898002EE8774F34EDC47F0243B7273|ycbG]-[gene|BA556E144975921DFDD598B0A7480C65176F0F14|ycbH]-[gene|349C99C258331962455100E2662DA2272E946C8A|ycbJ]
    description
    [Pubmed|12044674]

    regulatory mechanism

  • [protein|1A65880F68898002EE8774F34EDC47F0243B7273|YcbG]: repression, [Pubmed|12044674], in [regulon|1A65880F68898002EE8774F34EDC47F0243B7273|YcbG regulon]
  • [protein|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB]: repression, [Pubmed|18840696], in [regulon|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB regulon]
  • regulation

  • induced by D-glucarate/galactarate ([protein|search|YcbG]) [Pubmed|12044674]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-C031 (ycbH::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2029 NBRP B. subtilis, Japan]
  • BKE02510 (Δ[gene|BA556E144975921DFDD598B0A7480C65176F0F14|ycbH]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE02510 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATGAAAATCACTCCTCA, downstream forward: _UP4_TGATTCATGTTTTTATAGCG
  • BKK02510 (Δ[gene|BA556E144975921DFDD598B0A7480C65176F0F14|ycbH]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK02510 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATGAAAATCACTCCTCA, downstream forward: _UP4_TGATTCATGTTTTTATAGCG
  • References

  • 12044674