SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


response regulator aspartate phosphatase, dephosphorylates [protein|9896B99346B0D3F6D57F57377DB253B46135A37A|Spo0F]-P, control of the phosphorelay, control of [protein|7832489F11F606BCF637EC23BAAB41AD10237EBB|ComA] activity
49.96 kDa
protein length
376 aa Sequence Blast
gene length
1131 bp Sequence Blast
control of sporulation initiation and [protein|7832489F11F606BCF637EC23BAAB41AD10237EBB|ComA] activity
response regulator aspartate phosphatase

Genomic Context



  • [category|SW 3|Information processing] → [category|SW 3.3|Protein synthesis, modification and degradation] → [category|SW 3.3.4|Protein modification] → [category|SW|Protein phosphatases]
  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW|Control of two-component response regulators] → [category|SW|Response regulator aspartate phosphatase]
  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.7|phosphorelay] → [category|SW|Phosphatases controlling the phosphorelay]
  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.8|Quorum sensing]
  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.2|phosphorelay] → [category|SW|Phosphatases controlling the phosphorelay]
  • Gene

    750,959 → 752,089

    The protein

    Catalyzed reaction/ biological activity

  • binds to and thereby inhibits [protein|7832489F11F606BCF637EC23BAAB41AD10237EBB|ComA] activity [Pubmed|17581123]
  • RapH dephosphorylates [protein|9896B99346B0D3F6D57F57377DB253B46135A37A|Spo0F]-P and thereby controls the [SW|phosphorelay] [Pubmed|17581123]
  • in addition to dephosphorylating [protein|9896B99346B0D3F6D57F57377DB253B46135A37A|Spo0F], RapH can antagonize sporulation by sterically blocking phosphoryl transfer to and from [protein|9896B99346B0D3F6D57F57377DB253B46135A37A|Spo0F] [Pubmed|21346797]
  • Protein family

  • [SW|RAP family] (according to UniProt)
  • [SW|Domains]

  • six [SW|TPR repeat|tetratrichopeptide repeats] (according to UniProt)
  • Effectors of protein activity

  • interaction with [protein|4FA7D6E6316A6FC71C10C692D125833263894020|PhrH] inhibits dephosphorylation of [protein|9896B99346B0D3F6D57F57377DB253B46135A37A|Spo0F] and sequestration of [protein|7832489F11F606BCF637EC23BAAB41AD10237EBB|ComA] by [protein|BA85E2C2E2A6B76FAFA31EBDBF466324C9B021C8|RapH] [Pubmed|21908671]
  • Structure

  • [PDB|3Q15] ([protein|BA85E2C2E2A6B76FAFA31EBDBF466324C9B021C8|RapH]-[protein|9896B99346B0D3F6D57F57377DB253B46135A37A|Spo0F] complex) [Pubmed|21346797]
  • Expression and Regulation



    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|21908671], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|972401B6AF56EC67FE6F1C3FEA9E2A9FC77C7672|RghR]: repression, [Pubmed|16553878], in [regulon|972401B6AF56EC67FE6F1C3FEA9E2A9FC77C7672|RghR regulon]
  • [protein|08CFA2C72931A75532D4289BC1D18A826DE9F9CA|ComK]: activation, [Pubmed|11948146,11918817], in [regulon|08CFA2C72931A75532D4289BC1D18A826DE9F9CA|ComK regulon]
  • [protein|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB]: repression, [Pubmed|20817675], in [regulon|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB regulon]
  • regulation

  • ''[protein|search|rapH]'': repressed by [protein|search|RghR] [Pubmed|16553878]
  • view in new tab

    Biological materials


  • MGNA-A013 (rapH::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE06830 (Δ[gene|BA85E2C2E2A6B76FAFA31EBDBF466324C9B021C8|rapH]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAACGGCTTCCCTCCTTCTC, downstream forward: _UP4_GATATTCTAAAAGGAGAGTG
  • BKK06830 (Δ[gene|BA85E2C2E2A6B76FAFA31EBDBF466324C9B021C8|rapH]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAACGGCTTCCCTCCTTCTC, downstream forward: _UP4_GATATTCTAAAAGGAGAGTG
  • References

  • 16553878,17581123,11948146,11918817,20817675,21346797,21908671