SubtiBank SubtiBank
rapH
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

rapH

response regulator aspartate phosphatase, dephosphorylates [protein|9896B99346B0D3F6D57F57377DB253B46135A37A|Spo0F]-P, control of the phosphorelay, control of [protein|7832489F11F606BCF637EC23BAAB41AD10237EBB|ComA] activity
locus
BSU_06830
pI
6.12
mw
49.96 kDa
protein length
376 aa Sequence Blast
gene length
1131 bp Sequence Blast
function
control of sporulation initiation and [protein|7832489F11F606BCF637EC23BAAB41AD10237EBB|ComA] activity
product
response regulator aspartate phosphatase
essential
no
synonyms
yeeH,yzqA

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.3|Protein synthesis, modification and degradation] → [category|SW 3.3.4|Protein modification] → [category|SW 3.3.4.4|Protein phosphatases]
  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW 3.4.2.2|Control of two-component response regulators] → [category|SW 3.4.2.2.2|Response regulator aspartate phosphatase]
  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.7|phosphorelay] → [category|SW 3.4.7.5|Phosphatases controlling the phosphorelay]
  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.8|Quorum sensing]
  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.2|phosphorelay] → [category|SW 4.2.2.5|Phosphatases controlling the phosphorelay]
  • Gene

    Coordinates
    750,959 → 752,089

    The protein

    Catalyzed reaction/ biological activity

  • binds to and thereby inhibits [protein|7832489F11F606BCF637EC23BAAB41AD10237EBB|ComA] activity [Pubmed|17581123]
  • RapH dephosphorylates [protein|9896B99346B0D3F6D57F57377DB253B46135A37A|Spo0F]-P and thereby controls the [SW|phosphorelay] [Pubmed|17581123]
  • in addition to dephosphorylating [protein|9896B99346B0D3F6D57F57377DB253B46135A37A|Spo0F], RapH can antagonize sporulation by sterically blocking phosphoryl transfer to and from [protein|9896B99346B0D3F6D57F57377DB253B46135A37A|Spo0F] [Pubmed|21346797]
  • Protein family

  • [SW|RAP family] (according to UniProt)
  • [SW|Domains]

  • six [SW|TPR repeat|tetratrichopeptide repeats] (according to UniProt)
  • Effectors of protein activity

  • interaction with [protein|4FA7D6E6316A6FC71C10C692D125833263894020|PhrH] inhibits dephosphorylation of [protein|9896B99346B0D3F6D57F57377DB253B46135A37A|Spo0F] and sequestration of [protein|7832489F11F606BCF637EC23BAAB41AD10237EBB|ComA] by [protein|BA85E2C2E2A6B76FAFA31EBDBF466324C9B021C8|RapH] [Pubmed|21908671]
  • Structure

  • [PDB|3Q15] ([protein|BA85E2C2E2A6B76FAFA31EBDBF466324C9B021C8|RapH]-[protein|9896B99346B0D3F6D57F57377DB253B46135A37A|Spo0F] complex) [Pubmed|21346797]
  • Expression and Regulation

    Operons

    genes
    [gene|BA85E2C2E2A6B76FAFA31EBDBF466324C9B021C8|rapH]-[gene|4FA7D6E6316A6FC71C10C692D125833263894020|phrH]
    description
    [Pubmed|21908671]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|21908671], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|972401B6AF56EC67FE6F1C3FEA9E2A9FC77C7672|RghR]: repression, [Pubmed|16553878], in [regulon|972401B6AF56EC67FE6F1C3FEA9E2A9FC77C7672|RghR regulon]
  • [protein|08CFA2C72931A75532D4289BC1D18A826DE9F9CA|ComK]: activation, [Pubmed|11948146,11918817], in [regulon|08CFA2C72931A75532D4289BC1D18A826DE9F9CA|ComK regulon]
  • [protein|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB]: repression, [Pubmed|20817675], in [regulon|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB regulon]
  • regulation

  • ''[protein|search|rapH]'': repressed by [protein|search|RghR] [Pubmed|16553878]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-A013 (rapH::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/13 NBRP B. subtilis, Japan]
  • BKE06830 (Δ[gene|BA85E2C2E2A6B76FAFA31EBDBF466324C9B021C8|rapH]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE06830 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAACGGCTTCCCTCCTTCTC, downstream forward: _UP4_GATATTCTAAAAGGAGAGTG
  • BKK06830 (Δ[gene|BA85E2C2E2A6B76FAFA31EBDBF466324C9B021C8|rapH]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK06830 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAACGGCTTCCCTCCTTCTC, downstream forward: _UP4_GATATTCTAAAAGGAGAGTG
  • References

  • 16553878,17581123,11948146,11918817,20817675,21346797,21908671