SubtiBank SubtiBank
yobS
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.

yobS

similar to transcription factor
locus
BSU_19070
pI
6.23
mw
20.87 kDa
protein length
191 aa Sequence Blast
gene length
576 bp Sequence Blast
function
unknown
product
similar to transcription factor
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW 3.4.2.6|Transcription factor/ other/ based on similarity]
  • Gene

    Coordinates
    2,081,172 → 2,081,747

    The protein

    [SW|Domains]

  • [SW|HTH tetR-type domain] (aa 6-66) (according to UniProt)
  • Structure

  • [PDB|1ZK8] (from B. cereus, 42% identity)
  • Expression and Regulation

    Operons

    genes
    [gene|EDD0C5732E487A7F94684289F59B9130773316C1|yobT]-[gene|BB122C73972ACEA08DE97F95FC9AC249671C86A3|yobS]-[gene|6D9AAA63C4E43D2F80C7A2104BDF4D98A21C3B78|yobR]-[gene|6C67AD722D59671ED7589949690773732A8B845F|yobQ]-[gene|DA4A64BDF322EDE9EECE83AC9D4AAA01D3F16720|csaA]
    description
    [pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • MGNA-A315 (yobS::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/315 NBRP B. subtilis, Japan]
  • BKE19070 (Δ[gene|BB122C73972ACEA08DE97F95FC9AC249671C86A3|yobS]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE19070 BGSC], [Pubmed|28189581], upstream reverse: _UP1_ACCTATTCTCGGTGACATGC, downstream forward: _UP4_TAAACAAATAAATGGATGTC
  • BKK19070 (Δ[gene|BB122C73972ACEA08DE97F95FC9AC249671C86A3|yobS]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK19070 BGSC], [Pubmed|28189581], upstream reverse: _UP1_ACCTATTCTCGGTGACATGC, downstream forward: _UP4_TAAACAAATAAATGGATGTC