SubtiBank SubtiBank
glpD
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

glpD

glycerol-3-phosphate dehydrogenase (menaquinone 7)
locus
BSU_09300
pI
8.00
mw
62.36 kDa
protein length
555 aa Sequence Blast
gene length
1668 bp Sequence Blast
function
glycerol utilization
product
glycerol-3-phosphate dehydrogenase (menaquinone 7)
essential
no
ec
1.1.5.3
synonyms

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.2|Carbon metabolism] → [category|SW 2.2.2|Utilization of specific carbon sources] → [category|SW 2.2.2.3|Utilization of glycerol/ glycerol-3-phosphate]
  • [category|SW 2|Metabolism] → [category|SW 2.4|Lipid metabolism] → [category|SW 2.4.1|Utilization of lipids] → [category|SW 2.4.1.1|Utilization of phospholipids]
  • Gene

    Coordinates
    1,004,975 → 1,006,642

    The protein

    Catalyzed reaction/ biological activity

  • quinone + sn-glycerol 3-phosphate --> quinol + dihydroxyacetone phosphate (according to UniProt)
  • Protein family

  • FAD-dependent glycerol-3-phosphate dehydrogenase family (single member, according to UniProt)
  • [SW|Cofactors]

  • FAD (according to UniProt)
  • Structure

  • [PDB|3DA1] (from ''Bacillus halodurans'', 57% identity, 72% similarity)
  • [SW|Localization]

  • cytoplasm (according to Swiss-Prot)
  • Expression and Regulation

    Operons

    genes
    [gene|BB42AE1AAFA3229649A8E210C1F6D7B61AF38BA1|glpD]
    description
    [Pubmed|2127799]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|1809833], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA]: repression, in [regulon|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA regulon]
  • [protein|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB]: activation, [Pubmed|20817675], in [regulon|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB regulon]
  • [protein|38767691AE7E09F46B9E97A60BF5358C1876EDF8|GlpP]: antitermination, at a [SW|RNA switch] [Pubmed|1809833], in [regulon|38767691AE7E09F46B9E97A60BF5358C1876EDF8|GlpP regulon]
  • regulation

  • induced by glycerol ([protein|search|GlpP]) [Pubmed|1809833]
  • view in new tab

    Biological materials

    Mutant

  • QB5347 (cat), available in the [SW|Stülke] lab
  • BKE09300 (Δ[gene|BB42AE1AAFA3229649A8E210C1F6D7B61AF38BA1|glpD]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE09300 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTACGTTTCCTCCTTGTT, downstream forward: _UP4_TAAATCATAACGGGCTGTCT
  • BKK09300 (Δ[gene|BB42AE1AAFA3229649A8E210C1F6D7B61AF38BA1|glpD]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK09300 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTACGTTTCCTCCTTGTT, downstream forward: _UP4_TAAATCATAACGGGCTGTCT
  • References

  • 8825777,1479885,9595668,9493382,20817675