SubtiBank SubtiBank
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.


signal recognition particle-like GTPase, placement and assembly of flagella, control of basal body position
40.99 kDa
protein length
366 aa Sequence Blast
gene length
1101 bp Sequence Blast
placement and assembly of polar flagella
signal recognition particle-like GTPase

Genomic Context



  • [category|SW 4|Lifestyles] → [category|SW 4.1|Exponential and early post-exponential lifestyles] → [category|SW 4.1.1|Motility and chemotaxis] → [category|SW|Flagellar proteins]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    1,709,747 → 1,710,847

    Phenotypes of a mutant

  • inactivation of ''[gene|BB6F5D7463EF96E2C6344D0BC30A227C5E3B5817|flhF]'' confers resistance to high concentrations of Zn(II) [Pubmed|27935957]
  • The protein

    Catalyzed reaction/ biological activity

  • GTPase activity [Pubmed|22056770]
  • placement of the first flagellar protein, [protein|EB815705133E3318F655F6024B7D9BA587FD1DDA|FliF] [Pubmed|22056770]
  • Protein family

  • GTP-binding SRP family (with [protein|EC025F78D0BCBD91162BAAB9EAB7D3837E0A3208|Ffh] and [protein|D519765BF5261E48512CE86245BD7B733F188D4A|FtsY], according to UniProt)
  • Effectors of protein activity

  • interaction with [protein|D6D34E68FB3BAAACB533F98290FD363A5B00B2C6|FlhG] activates the GTPase activity of [protein|BB6F5D7463EF96E2C6344D0BC30A227C5E3B5817|FlhF] [Pubmed|22056770]
  • Structure

  • [PDB|2PX3] (complexed with GTP-Mg2+) [Pubmed|17699634]
  • [PDB|3SYN] (complex with its activator [protein|D6D34E68FB3BAAACB533F98290FD363A5B00B2C6|FlhG]) [Pubmed|22056770]
  • [SW|Localization]

  • cell membrane (according to UniProt)
  • Expression and Regulation



    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|9657996], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • [protein|7024E4162A6D827069F882FDEACA696EBC05DD40|SigD]: sigma factor, [Pubmed|20233303], in [regulon|7024E4162A6D827069F882FDEACA696EBC05DD40|SigD regulon]
  • regulatory mechanism

  • [protein|2C54FE2ADC82FF414D732018C90649D477A925AD|Spo0A]: repression, in [regulon|2C54FE2ADC82FF414D732018C90649D477A925AD|Spo0A regulon]
  • [protein|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|CodY]: repression, in [regulon|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|CodY regulon]
  • [protein|D343D2096664A972026D911E7A17A35C7B1CD1C9|DegU]: regulation, in [regulon|D343D2096664A972026D911E7A17A35C7B1CD1C9|DegU regulon]
  • [protein|5D479874B43F521DB52EDC2C27CDE4967F22DE47|SwrA]: activation, in [regulon|5D479874B43F521DB52EDC2C27CDE4967F22DE47|SwrA regulon]
  • regulation

  • see [SW|fla-che operon]
  • view in new tab


    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|9657996], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • [protein|7024E4162A6D827069F882FDEACA696EBC05DD40|SigD]: sigma factor, [Pubmed|9657996], in [regulon|7024E4162A6D827069F882FDEACA696EBC05DD40|SigD regulon]
  • regulatory mechanism

  • [protein|2C54FE2ADC82FF414D732018C90649D477A925AD|Spo0A]: repression, in [regulon|2C54FE2ADC82FF414D732018C90649D477A925AD|Spo0A regulon]
  • [protein|5D479874B43F521DB52EDC2C27CDE4967F22DE47|SwrA]: activation, in [regulon|5D479874B43F521DB52EDC2C27CDE4967F22DE47|SwrA regulon]
  • [protein|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|CodY]: repression, in [regulon|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|CodY regulon]
  • [protein|D343D2096664A972026D911E7A17A35C7B1CD1C9|DegU]: repression, in [regulon|D343D2096664A972026D911E7A17A35C7B1CD1C9|DegU regulon]
  • regulation

  • expression during spore [SW|germination] is strongly reduced under conditions of osmotic stress [Pubmed|27766092]
  • view in new tab

    Biological materials


  • 1A925 ( ''flhF''::''cat''), [Pubmed|15317803], available at [ BGSC]
  • BKE16400 (Δ[gene|BB6F5D7463EF96E2C6344D0BC30A227C5E3B5817|flhF]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTAAATATCCACCACTCC, downstream forward: _UP4_CTGTGCAGATGAACAGATAT
  • BKK16400 (Δ[gene|BB6F5D7463EF96E2C6344D0BC30A227C5E3B5817|flhF]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTAAATATCCACCACTCC, downstream forward: _UP4_CTGTGCAGATGAACAGATAT
  • References


  • 26195616
  • Original Publications

  • 1447978,17699634,17850253,15317803,14651647,9657996,8157612,15175317,22056770,23190039,24386445,27935957