SubtiBank SubtiBank
ykaA
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.

ykaA

unknown
locus
BSU_12850
pI
4.91
mw
23.70 kDa
protein length
205 aa Sequence Blast
gene length
618 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 6|Groups of genes] → [category|SW 6.7|Proteins of unknown function]
  • Gene

    Coordinates
    1,350,482 → 1,351,099

    The protein

    Protein family

  • UPF0111 family (single member, according to UniProt)
  • Structure

  • [PDB|3L39] (from Bacteroides thetaiotamicron, 28% identity)
  • Expression and Regulation

    Operons

    genes
    [gene|BBA93C5BAA044DA61A2D1E0EE850A12391E8A3E3|ykaA]-[gene|BBFA6A5EE16CE6203AF89573F87678395277C9E8|pit]
    description
    [Pubmed|22383849]

    regulatory mechanism

  • [protein|2C54FE2ADC82FF414D732018C90649D477A925AD|Spo0A]: repression, [Pubmed|14651647], in [regulon|2C54FE2ADC82FF414D732018C90649D477A925AD|Spo0A regulon]
  • regulation

  • repressed under conditions that trigger sporulation ([SW|Spo0A]) [Pubmed|14651647]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-B307 (ykaA::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1306 NBRP B. subtilis, Japan]
  • BKE12850 (Δ[gene|BBA93C5BAA044DA61A2D1E0EE850A12391E8A3E3|ykaA]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE12850 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTAAAAACCCTCCATAGT, downstream forward: _UP4_TAACGAGGGGTAAAAATGGA
  • BKK12850 (Δ[gene|BBA93C5BAA044DA61A2D1E0EE850A12391E8A3E3|ykaA]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK12850 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTAAAAACCCTCCATAGT, downstream forward: _UP4_TAACGAGGGGTAAAAATGGA
  • References

  • 14651647