SubtiBank SubtiBank
malS
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

malS

malate dehydrogenase (decarboxylating), forms a transhydrogenation cycle with [protein|search|YtsJ ]for balancing of NADPH
locus
BSU_29880
pI
4.89
mw
61.98 kDa
protein length
566 aa Sequence Blast
gene length
1701 bp Sequence Blast
function
malate utilization
product
malate dehydrogenase (decarboxylating)
essential
no
ec
1.1.1.38
synonyms

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.2|Carbon metabolism] → [category|SW 2.2.2|Utilization of specific carbon sources] → [category|SW 2.2.2.1|Utilization of organic acids]
  • Gene

    Coordinates
    3,056,849 → 3,058,549

    The protein

    Catalyzed reaction/ biological activity

  • (S)-malate NAD = pyruvate CO2 NADH (according to Swiss-Prot) malate -→ pyruvate
  • Protein family

  • [SW|malic enzymes family] (according to UniProt)
  • Paralogous protein(s)

  • [protein|4F30A4412768E6313F57BD56C4EF5079F500E0C4|MaeA], [protein|45229A538D5124B60CE05DDC8699B9BC3D5AD9FF|YtsJ], [protein|160EBB7885D7C7FD30A6E35605A862C156E2DA80|MleA]
  • Structure

  • [PDB|1LLQ] (from ''Ascaris suum'', 40% identity) [Pubmed|12033925]
  • Expression and Regulation

    Operons

    genes
    [gene|53259B300509E6B6DAF3ED106D1DDEDC99B5532B|ytnP]-[gene|BBBCD5F56779895189E21076AF165B901F654534|malS]
    description
    [Pubmed|22383849]
    view in new tab

    genes
    [gene|BBBCD5F56779895189E21076AF165B901F654534|malS]
    description
    [Pubmed|9387221]
    view in new tab

    Biological materials

    Mutant

  • GP1142 (Δ[gene|BBBCD5F56779895189E21076AF165B901F654534|malS]::spc) available in [SW|Jörg Stülke]'s lab
  • BKE29880 (Δ[gene|BBBCD5F56779895189E21076AF165B901F654534|malS]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE29880 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACCCTGCCTCTTCCTTTCT, downstream forward: _UP4_TAATAAAAAAGAGCCGCTGC
  • BKK29880 (Δ[gene|BBBCD5F56779895189E21076AF165B901F654534|malS]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK29880 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACCCTGCCTCTTCCTTTCT, downstream forward: _UP4_TAATAAAAAAGAGCCGCTGC
  • References

  • 9387221,16788182,12949160,23136871,22740702,12033925