SubtiBank SubtiBank
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.


malate dehydrogenase (decarboxylating), forms a transhydrogenation cycle with [protein|search|YtsJ ]for balancing of NADPH
61.98 kDa
protein length
566 aa Sequence Blast
gene length
1701 bp Sequence Blast
malate utilization
malate dehydrogenase (decarboxylating)

Genomic Context



  • [category|SW 2|Metabolism] → [category|SW 2.2|Carbon metabolism] → [category|SW 2.2.2|Utilization of specific carbon sources] → [category|SW|Utilization of organic acids]
  • Gene

    3,056,849 → 3,058,549

    The protein

    Catalyzed reaction/ biological activity

  • (S)-malate + NAD+ --> CO2 + NADH + pyruvate (according to UniProt)
  • H+ + oxaloacetate --> CO2 + pyruvate (according to UniProt)
  • Protein family

  • [SW|malic enzymes family] (according to UniProt)
  • Paralogous protein(s)

  • [protein|4F30A4412768E6313F57BD56C4EF5079F500E0C4|MaeA], [protein|45229A538D5124B60CE05DDC8699B9BC3D5AD9FF|YtsJ], [protein|160EBB7885D7C7FD30A6E35605A862C156E2DA80|MleA]
  • Structure

  • [PDB|1LLQ] (from ''Ascaris suum'', 40% identity) [Pubmed|12033925]
  • Expression and Regulation


    view in new tab

    view in new tab

    Biological materials


  • GP1142 (Δ[gene|BBBCD5F56779895189E21076AF165B901F654534|malS]::spc) available in [SW|Jörg Stülke]'s lab
  • BKE29880 (Δ[gene|BBBCD5F56779895189E21076AF165B901F654534|malS]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACCCTGCCTCTTCCTTTCT, downstream forward: _UP4_TAATAAAAAAGAGCCGCTGC
  • BKK29880 (Δ[gene|BBBCD5F56779895189E21076AF165B901F654534|malS]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACCCTGCCTCTTCCTTTCT, downstream forward: _UP4_TAATAAAAAAGAGCCGCTGC
  • References

  • 9387221,16788182,12949160,23136871,22740702,12033925