SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


cell wall-associated protein precursor, contact-dependent growth inhibition protein
258.02 kDa
protein length
2334 aa Sequence Blast
gene length
7005 bp Sequence Blast
intercellular competition
cell wall-associated protein precursor

Genomic Context



  • [category|SW 1|Cellular processes] → [category|SW 1.1|Cell envelope and cell division] → [category|SW 1.1.5|Cell wall/ other]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.18|Toxins, antitoxins and immunity against toxins/ based on similarity]
  • [category|SW 6|Groups of genes] → [category|SW 6.12|Secreted proteins]
  • Gene

    4,023,544 → 4,030,548

    The protein

    Catalyzed reaction/ biological activity

  • the C-terminal toxic domain has RNase activity (cleaves tRNAs) [Pubmed|23572593]
  • Protein family

  • RHS/WapA nuclease family (single member, according to UniProt)
  • [SW|Domains]

  • cell wall binding domain as retention signal
  • C-terminal toxic domain with RNase activity (cleaves tRNAs) [Pubmed|23572593]
  • Has two ligand-binding domains; the N-terminus has three 101 AA repeats which are responsible for cell wall binding; the C-terminus consists of two blocks of residues with a conserved motif repeated 31 times (according to UniProt)
  • Effectors of protein activity

  • [protein|C7400733DB8835A204A7FF26C87A92A15C5F318C|WapI] inhibits the toxic activity of [protein|BBC06DA57CAC2B2378763E0839C6C31AFBEA0417|WapA] [Pubmed|23572593]
  • [SW|Localization]

  • extracellular (signal peptide), cell wall binding domain as retention signal, major constituent of the secretome [Pubmed|18957862]
  • Expression and Regulation



    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|23199363], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|D343D2096664A972026D911E7A17A35C7B1CD1C9|DegU]: repression, [protein|D343D2096664A972026D911E7A17A35C7B1CD1C9|DegU]-P, [Pubmed|9537385], in [regulon|D343D2096664A972026D911E7A17A35C7B1CD1C9|DegU regulon]
  • [protein|7098319D8E88FDC2A629A3F4A21507FD7A649385|YvrHb]: activation, [Pubmed|16306698], in [regulon|7098319D8E88FDC2A629A3F4A21507FD7A649385|YvrHb regulon]
  • [protein|7F340423A34CE40D1F1AA8D373F7C4B859A6496D|WalR]: repression, [Pubmed|23199363], in [regulon|7F340423A34CE40D1F1AA8D373F7C4B859A6496D|WalR regulon]
  • regulation

  • repressed at high salt concentration ([protein|D343D2096664A972026D911E7A17A35C7B1CD1C9|DegU]-P) [Pubmed|32419322,9537385]
  • Additional information

  • [protein|638D6D2FCCA2A167EFED05CB4E60C2D78D5319AE|PhoP]∼P binds to the promoter region, but regulation has not been explored [pubmed|25666134]
  • view in new tab

    Biological materials


  • BKE39230 (Δ[gene|BBC06DA57CAC2B2378763E0839C6C31AFBEA0417|wapA]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTCCTCTCTCCTTTTGT, downstream forward: _UP4_TAATAAGGTTAAGCGAGGGG
  • BKK39230 (Δ[gene|BBC06DA57CAC2B2378763E0839C6C31AFBEA0417|wapA]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTCCTCTCTCCTTTTGT, downstream forward: _UP4_TAATAAGGTTAAGCGAGGGG
  • References

  • 11987133,16672620,18957862,16306698,9537385,21821766,23572593,23199363,25666134,26923784,28827522,32419322