SubtiBank SubtiBank
rpmGB
The papers of the month are back! Check them out! Link here

rpmGB

ribosomal protein
locus
BSU00990
pI
9.89
mw
5.36 kDa
protein length
gene length
147 bp Sequence Blast
function
translation
product
ribosomal protein L33b
essential
no
synonyms
rpmG

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.3|Protein synthesis, modification and degradation] → [category|SW 3.3.1|Translation] → [category|SW 3.3.1.4|Ribosomal proteins]
  • Gene

    Coordinates
    117,349 → 117,498

    The protein

    Protein family

  • [SW|ribosomal protein] L33P family (according to Swiss-Prot)
  • Paralogous protein(s)

  • [protein|D73FC9CAD929919050837824B4794F9FC9E83052|RpmGA], [protein|5189DF2F6144CD2429B5C01B1AD03BAE98307579|RpmGC]
  • [SW|Cofactors]

  • requires zinc for activity [Pubmed|19648245]
  • Structure

  • [PDB|3J9W] (the [SW|ribosome]) [Pubmed|25903689]
  • Expression and Regulation

    Operons

    genes
    [gene|DC3449D5F195E5C2E9E14FEC95396C8F1FDF73B4|sigH]-[gene|BBD82B93D5E880AB7093ED53DDB149B0E0B3BAE4|rpmGB]-[gene|1007EA15FB7AF81A44400287DB68BCC497158ACF|secE]
    description
    [Pubmed|22383849]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|1898930], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB]: repression, [Pubmed|7592498], in [regulon|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB regulon]
  • regulation

  • repressed during logrithmic growth ([protein|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB]) [Pubmed|7592498]
  • view in new tab

    Biological materials

    Mutant

  • BKE00990 (Δ[gene|BBD82B93D5E880AB7093ED53DDB149B0E0B3BAE4|rpmGB]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE00990 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTCATTACACCTTTTTC, downstream forward: _UP4_TAGTTTTTGCGCTTTTAAAT
  • BKK00990 (Δ[gene|BBD82B93D5E880AB7093ED53DDB149B0E0B3BAE4|rpmGB]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK00990 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTCATTACACCTTTTTC, downstream forward: _UP4_TAGTTTTTGCGCTTTTAAAT
  • References

  • 19648245,19653700,23002217,25903689