SubtiBank SubtiBank
rpmGB
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

rpmGB

ribosomal protein
locus
BSU_00990
pI
9.89
mw
5.36 kDa
protein length
gene length
150 bp Sequence Blast
function
translation
product
ribosomal protein L33b
essential
no
synonyms
rpmG

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.3|Protein synthesis, modification and degradation] → [category|SW 3.3.1|Translation] → [category|SW 3.3.1.4|Ribosomal proteins]
  • Gene

    Coordinates
    117,349 → 117,498

    The protein

    Protein family

  • bacterial [SW|ribosomal protein] bL33 family (with [protein|D73FC9CAD929919050837824B4794F9FC9E83052|RpmGA] and [protein|5189DF2F6144CD2429B5C01B1AD03BAE98307579|RpmGC], according to UniProt)
  • Paralogous protein(s)

  • [protein|D73FC9CAD929919050837824B4794F9FC9E83052|RpmGA], [protein|5189DF2F6144CD2429B5C01B1AD03BAE98307579|RpmGC]
  • [SW|Cofactors]

  • requires zinc for activity [Pubmed|19648245]
  • Structure

  • [PDB|3J9W] (the [SW|ribosome]) [Pubmed|25903689]
  • [SW|Localization]

  • [SW|ribosome] (according to UniProt)
  • Expression and Regulation

    Operons

    genes
    [gene|DC3449D5F195E5C2E9E14FEC95396C8F1FDF73B4|sigH]-[gene|BBD82B93D5E880AB7093ED53DDB149B0E0B3BAE4|rpmGB]-[gene|1007EA15FB7AF81A44400287DB68BCC497158ACF|secE]
    description
    [Pubmed|22383849]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|1898930], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB]: repression, [Pubmed|7592498], in [regulon|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB regulon]
  • regulation

  • repressed during logrithmic growth ([protein|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB]) [Pubmed|7592498]
  • view in new tab

    Biological materials

    Mutant

  • BKE00990 (Δ[gene|BBD82B93D5E880AB7093ED53DDB149B0E0B3BAE4|rpmGB]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE00990 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTCATTACACCTTTTTC, downstream forward: _UP4_TAGTTTTTGCGCTTTTAAAT
  • BKK00990 (Δ[gene|BBD82B93D5E880AB7093ED53DDB149B0E0B3BAE4|rpmGB]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK00990 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTCATTACACCTTTTTC, downstream forward: _UP4_TAGTTTTTGCGCTTTTAAAT
  • References

  • 19648245,19653700,23002217,25903689