SubtiBank SubtiBank
The papers of the month are back! Check them out! Link here


required for normal spore cortex and coat synthesis, inhibits the proteolytic activity of [protein|search|FtsH ](adaptor protein)
2.88 kDa
protein length
gene length
spore cortex and coat synthesis
spore coat morphogenetic protein

Genomic Context



  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW|Spore coat proteins] → [category|SW|Class I]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    1,655,446 → 1,655,526

    Phenotypes of a mutant

  • reduction of sporulation efficiency due to defects in spore coat and cortex assembly [Pubmed|22463703]
  • The protein

    Catalyzed reaction/ biological activity

  • anchors the basement layer of the spore coat to the surface of the developing spore [Pubmed|22463703]
  • [SW|Domains]

  • contains an amphipathic alpha-helix
  • Structure

  • [PDB|2MVH] [Pubmed|25825747]
  • [SW|Localization]

  • around the surface of the developing forespore [Pubmed|22463703]
  • spore membrane, recognizes membrane curvature [Pubmed|19265022]
  • spore coat (basement), localization depends on [protein|A25C1530DA7BB007A288E525404E9F775E219FE8|SpoIVA] [Pubmed|22171814]
  • Expression and Regulation



    sigma factors

  • [protein|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE]: sigma factor, [Pubmed|8231808,15699190], in [regulon|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE regulon]
  • regulatory mechanism

  • [protein|90DCE4F286D2C151D8BDBF0E024E6BBEC94E2397|SpoIIID]: activation, [Pubmed|8231808], in [regulon|90DCE4F286D2C151D8BDBF0E024E6BBEC94E2397|SpoIIID regulon]
  • regulation

  • expressed in mother cell during sporulation ([protein|search|SigE], [SW|SpoIIID]) [Pubmed|8231808,15699190,19265022]
  • view in new tab

    Biological materials


  • BKE15810 (Δ[gene|BBDA32A4EE3389D6F4404F7B3DA9E13AC7BF8055|spoVM]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTTTGTCCCCTCCTATA, downstream forward: _UP4_TAATGCCCAGGGGTTCAAAG
  • BKK15810 (Δ[gene|BBDA32A4EE3389D6F4404F7B3DA9E13AC7BF8055|spoVM]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTTTGTCCCCTCCTATA, downstream forward: _UP4_TAATGCCCAGGGGTTCAAAG
  • References


  • 23202530,28408070
  • Original publications

  • 10913836,18820968,8231808,9922240,19265022,12562810,9287010,17427285,19775244,15699190,22463703,22171814,22882210,25625300,25825747,25854653,29102609