SubtiBank SubtiBank
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.


polysaccharide deacetylase
28.17 kDa
protein length
254 aa Sequence Blast
gene length
765 bp Sequence Blast
spore cortex formation
polysaccharide deacetylase

Genomic Context



  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW|Sporulation proteins/ other]
  • Gene

    159,779 → 160,543

    Phenotypes of a mutant

  • ''[gene|BBF22E368CB091678083934FD42BB11EA30B29DD|pdaB] [gene|BB0443D95581DCA66EDA390842945F105A71A371|ytrI]'' and ''[gene|BBF22E368CB091678083934FD42BB11EA30B29DD|pdaB] [gene|D5B9ACB1E447A893C99A4ACE1DA95EB38BCF971B|ytrH]'' mutants are deficient in sporulation
  • inactivation of ''[gene|BBF22E368CB091678083934FD42BB11EA30B29DD|pdaB]'' reduces sporulation efficiency to 5% that of wild type cells [Pubmed|26735940]
  • The protein

    Protein family

  • [SW|polysaccharide deacetylase family] (according to UniProt)
  • [SW|Domains]

  • [SW|NodB homology domain] (aa 57-237) (according to UniProt)
  • Structure

  • [PDB|4M1B] (from B. anthracis, 54% identity) [pubmed|24637747]
  • [SW|Localization]

  • forespore (according to Swiss-Prot)
  • Expression and Regulation



    sigma factors

  • [protein|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE]: sigma factor, [Pubmed|15699190,12662922], in [regulon|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE regulon]
  • regulatory mechanism

  • [protein|90DCE4F286D2C151D8BDBF0E024E6BBEC94E2397|SpoIIID]: repression, [Pubmed|12662922], in [regulon|90DCE4F286D2C151D8BDBF0E024E6BBEC94E2397|SpoIIID regulon]
  • regulation

  • expressed during sporulation in the mother cell [Pubmed|12662922]
  • additional information

  • the mRNA is very stable (half-life > 15 min) [ PubMed]
  • view in new tab

    Biological materials


  • MGNA-B947 (ybaN::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE01570 (Δ[gene|BBF22E368CB091678083934FD42BB11EA30B29DD|pdaB]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACTGATGATGCCTCCTTAT, downstream forward: _UP4_GCCAAATCCGCAGAGGTAAA
  • BKK01570 (Δ[gene|BBF22E368CB091678083934FD42BB11EA30B29DD|pdaB]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACTGATGATGCCTCCTTAT, downstream forward: _UP4_GCCAAATCCGCAGAGGTAAA
  • References

  • 12662922,12884008,15547282,15598884,26735940,24637747