SubtiBank SubtiBank
pdaB
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.

pdaB

polysaccharide deacetylase
locus
BSU_01570
pI
9.18
mw
28.17 kDa
protein length
254 aa Sequence Blast
gene length
765 bp Sequence Blast
function
spore cortex formation
product
polysaccharide deacetylase
essential
no
synonyms
ybaN

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW 4.2.1.4|Sporulation proteins/ other]
  • Gene

    Coordinates
    159,779 → 160,543

    Phenotypes of a mutant

  • ''[gene|BBF22E368CB091678083934FD42BB11EA30B29DD|pdaB] [gene|BB0443D95581DCA66EDA390842945F105A71A371|ytrI]'' and ''[gene|BBF22E368CB091678083934FD42BB11EA30B29DD|pdaB] [gene|D5B9ACB1E447A893C99A4ACE1DA95EB38BCF971B|ytrH]'' mutants are deficient in sporulation
  • inactivation of ''[gene|BBF22E368CB091678083934FD42BB11EA30B29DD|pdaB]'' reduces sporulation efficiency to 5% that of wild type cells [Pubmed|26735940]
  • The protein

    Protein family

  • [SW|polysaccharide deacetylase family] (according to UniProt)
  • [SW|Domains]

  • [SW|NodB homology domain] (aa 57-237) (according to UniProt)
  • Structure

  • [PDB|4M1B] (from B. anthracis, 54% identity) [pubmed|24637747]
  • [SW|Localization]

  • forespore (according to Swiss-Prot)
  • Expression and Regulation

    Operons

    genes
    [gene|BBF22E368CB091678083934FD42BB11EA30B29DD|pdaB]
    description
    [Pubmed|12662922]

    sigma factors

  • [protein|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE]: sigma factor, [Pubmed|15699190,12662922], in [regulon|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE regulon]
  • regulatory mechanism

  • [protein|90DCE4F286D2C151D8BDBF0E024E6BBEC94E2397|SpoIIID]: repression, [Pubmed|12662922], in [regulon|90DCE4F286D2C151D8BDBF0E024E6BBEC94E2397|SpoIIID regulon]
  • regulation

  • expressed during sporulation in the mother cell [Pubmed|12662922]
  • additional information

  • the mRNA is very stable (half-life > 15 min) [http://www.ncbi.nlm.nih.gov/sites/entrez/12884008 PubMed]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-B947 (ybaN::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1946 NBRP B. subtilis, Japan]
  • BKE01570 (Δ[gene|BBF22E368CB091678083934FD42BB11EA30B29DD|pdaB]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE01570 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACTGATGATGCCTCCTTAT, downstream forward: _UP4_GCCAAATCCGCAGAGGTAAA
  • BKK01570 (Δ[gene|BBF22E368CB091678083934FD42BB11EA30B29DD|pdaB]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK01570 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACTGATGATGCCTCCTTAT, downstream forward: _UP4_GCCAAATCCGCAGAGGTAAA
  • References

  • 12662922,12884008,15547282,15598884,26735940,24637747