SubtiBank SubtiBank
glcT
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

glcT

transcriptional antiterminator, controls expression of the [gene|B5E7EB475434E96786C577AE709A21BD702733D8|ptsG]-[gene|29B793660E4D30C0656248F3EF403FEF76FB9025|ptsH]-[gene|14ED1AF5038F43F3B151FCBABE6CFC5A2DA3AA6E|ptsI] operon
locus
BSU_13880
pI
7.01
mw
33.03 kDa
protein length
288 aa Sequence Blast
gene length
867 bp Sequence Blast
function
control of glucose uptake
product
transcriptional antiterminator of the [gene|B5E7EB475434E96786C577AE709A21BD702733D8|ptsG]-[gene|29B793660E4D30C0656248F3EF403FEF76FB9025|ptsH]-[gene|14ED1AF5038F43F3B151FCBABE6CFC5A2DA3AA6E|ptsI] operon
essential
no
synonyms
ykwA

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.2|Carbon metabolism] → [category|SW 2.2.1|Carbon core metabolism] → [category|SW 2.2.1.1|Glycolysis]
  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW 3.4.2.3|PRD-type regulators]
  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.4|RNA binding regulators]
  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.4|Phosphorylation on a His residue]
  • Gene

    Coordinates
    1,456,092 → 1,456,958

    The protein

    Catalyzed reaction/ biological activity

  • [SW|PRD-containing transcription factors|transcription antiterminator] , RNA-binding protein, binds the ''[gene|B5E7EB475434E96786C577AE709A21BD702733D8|ptsG]'' RAT sequence
  • Protein family

  • [SW|PRD-containing transcription factors]
  • Paralogous protein(s)

  • [protein|EB330AB3DC6C8C3EC72C4CAFA2BC59CC485EE344|SacY], [protein|FAC682CCD66056A8CBB9AE5F4BF51C1AADEBBD2C|LicT], [protein|6796E1C147AA21E919A42A953884DC24E182F430|SacT]
  • [SW|Domains]

  • RNA-binding domain (N-terminal, constitutive antiterminator)
  • 2x [SW|PTS] regulation domains ([SW|PRD]s) (C-terminal, neg. regulated by [protein|B5E7EB475434E96786C577AE709A21BD702733D8|PtsG])
  • Modification

  • phosphorylation (His104)
  • Structure

  • [PDB|3RIO] (RBD-[SW|PRD]-I) [Pubmed|22750856]
  • [PDB|3GWH] ([SW|PRD]-II) [Pubmed|19684596]
  • Expression and Regulation

    Operons

    genes
    [gene|C95EEAC79B9E823BBBCF6B1960DABCCBB2AC03A4|papB]-[gene|6FDE01EEFCDB2F949A902DFD76A341410B867E88|ykvZ]-[gene|BC0DF593AE969F1DBC5E9E2BACF1C00BE4FEE449|glcT]
    description
    [Pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • available in [SW|Jörg Stülke]'s lab:
  • GP109 (Δ[gene|BC0DF593AE969F1DBC5E9E2BACF1C00BE4FEE449|glcT], in frame deletion)
  • GP778 (Δ[gene|BC0DF593AE969F1DBC5E9E2BACF1C00BE4FEE449|glcT]-[gene|B5E7EB475434E96786C577AE709A21BD702733D8|ptsG]-[gene|29B793660E4D30C0656248F3EF403FEF76FB9025|ptsH]-[gene|14ED1AF5038F43F3B151FCBABE6CFC5A2DA3AA6E|ptsI]::spc) [Pubmed|22722928]
  • GP926 (Δ[gene|BC0DF593AE969F1DBC5E9E2BACF1C00BE4FEE449|glcT]-[gene|B5E7EB475434E96786C577AE709A21BD702733D8|ptsG]::tet) [Pubmed|22722928]
  • BKE13880 (Δ[gene|BC0DF593AE969F1DBC5E9E2BACF1C00BE4FEE449|glcT]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE13880 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTCAATACCTCATATCGT, downstream forward: _UP4_TAAATTCAGTTTATCCTTAT
  • BKK13880 (Δ[gene|BC0DF593AE969F1DBC5E9E2BACF1C00BE4FEE449|glcT]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK13880 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTCAATACCTCATATCGT, downstream forward: _UP4_TAAATTCAGTTTATCCTTAT
  • Expression vectors

  • pGP124 (full length, in [SW|pWH844]), available in [SW|Jörg Stülke]'s lab
  • pGP114 (amino acids 1-60, RNA-binding domain, in [SW|pWH844]), available in [SW|Jörg Stülke]'s lab
  • pGP230 (amino acids 1-60, RNA-binding domain with thrombin cleavage site, in [SW|pWH844]), available in [SW|Jörg Stülke]'s lab
  • pGP164 (both PRDs, in [SW|pWH844]), in addition diverse Expression vector for phosphorylation site mutants and for RBD mutants (all in [SW|pWH844]), available in [SW|Jörg Stülke]'s lab
  • pGP424 (PRDI, in [SW|pWH844]), available in [SW|Jörg Stülke]'s lab
  • pGP425 (PRDII, in [SW|pWH844]), available in [SW|Jörg Stülke]'s lab
  • pGP442 (PRDI, in [SW|pGP570], with thrombin cleavage site), available in [SW|Jörg Stülke]'s lab
  • pGP443 (PRDII, in [SW|pGP570], with thrombin cleavage site), available in [SW|Jörg Stülke]'s lab
  • pGP575 (amino acids 1-60, RNA-binding domain with Strep-tag, in [SW|pGP574]), available in [SW|Jörg Stülke]'s lab
  • GFP fusion

  • GP1224 (spc, based on [SW|pGP1870]), available in [SW|Jörg Stülke]'s lab
  • FLAG-tag construct

  • GP1220 (spc, based on [SW|pGP1331]), available in [SW|Jörg Stülke]'s lab
  • labs

  • [SW|Jörg Stülke], University of Göttingen, Germany [http://wwwuser.gwdg.de/~genmibio/stuelke.html Homepage]
  • References

    Reviews

  • 9663674,18086213
  • Original publications

  • 11902727,9765562,12437213,10543968,17074746,15155854,14527945,19684596,22722928,20939030,22750856,30082753