SubtiBank SubtiBank


L-serine deaminase
23.67 kDa
protein length
220 aa Sequence Blast
gene length
663 bp Sequence Blast
serine utilization
L-serine deaminase (beta chain)

Genomic Context



  • [category|SW 2|Metabolism] → [category|SW 2.3|Amino acid/ nitrogen metabolism] → [category|SW 2.3.2|Utilization of amino acids] → [category|SW|Utilization of alanine/ serine]
  • Gene

    1,658,242 → 1,658,904

    The protein

    Catalyzed reaction/ biological activity

  • L-serine --> NH4+ + pyruvate (according to UniProt)
  • Protein family

  • iron-sulfur dependent L-serine dehydratase family (with [protein|8361D87307D2E8350945F592ABD24E2109E2E81A|SdaAA], according to UniProt)
  • [SW|Domains]

  • [SW|ACT domain] (aa 148-220) (according to UniProt)
  • [SW|Cofactors]

  • Fe-S cluster [pubmed|29292548]
  • Expression and Regulation


    view in new tab

    Biological materials


  • BKE15850 (Δ[gene|BC19D5B3764503298ED7136FC9F63A68F6AC464F|sdaAB]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGCTATTCCTCCTTATGA, downstream forward: _UP4_TAGCGAAAAGGGTCAGGAGG
  • BKK15850 (Δ[gene|BC19D5B3764503298ED7136FC9F63A68F6AC464F|sdaAB]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGCTATTCCTCCTTATGA, downstream forward: _UP4_TAGCGAAAAGGGTCAGGAGG
  • lacZ fusion

  • pGP2275 (in [SW|pAC5]) (GP2967), available in [SW|Jörg Stülke]'s lab
  • References

  • 22383849,22686449,24161940