SubtiBank SubtiBank
rapJ
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

rapJ

response regulator aspartate phosphatase, dephosphorylates [protein|9896B99346B0D3F6D57F57377DB253B46135A37A|Spo0F]-P
locus
BSU_02820
pI
4.90
mw
44.25 kDa
protein length
373 aa Sequence Blast
gene length
1122 bp Sequence Blast
function
control of the [SW|phosphorelay]
product
response regulator aspartate phosphatase
essential
no
synonyms
ycdE

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.3|Protein synthesis, modification and degradation] → [category|SW 3.3.4|Protein modification] → [category|SW 3.3.4.4|Protein phosphatases]
  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW 3.4.2.2|Control of two-component response regulators] → [category|SW 3.4.2.2.2|Response regulator aspartate phosphatase]
  • Gene

    Coordinates
    304,430 → 305,551

    The protein

    Catalyzed reaction/ biological activity

  • dephosphorylates [protein|9896B99346B0D3F6D57F57377DB253B46135A37A|Spo0F]-P [Pubmed|21346797]
  • Protein family

  • [SW|RAP family] (according to UniProt)
  • [SW|Domains]

  • RapJ is made up of the C-terminal tetratricopeptide repeat (TPR) domain (five [SW|TPR repeat|tetratrichopeptide repeats]) that is connected by a flexible helix containing linker to the N-terminal 3-helix bundle. Upon binding of the regulating peptide [protein|C0B7845F55A16300EB37F026C817AEC4F3BA3B6F|PhrC], the 3-helix bundle and the linker helix undergo a conformational change to form a TPR-like fold that merges with the existing C-terminal TPR domain. [Pubmed|23526881]
  • Effectors of protein activity

  • the interaction with [protein|C0B7845F55A16300EB37F026C817AEC4F3BA3B6F|PhrC] inactivates [protein|BC28167FE175BFD7DBF1B07C54D3512184B95B8F|RapJ] [Pubmed|23526881]
  • Structure

  • [PDB|4GYO] (complex [protein|BC28167FE175BFD7DBF1B07C54D3512184B95B8F|RapJ]-[protein|C0B7845F55A16300EB37F026C817AEC4F3BA3B6F|PhrC]) [Pubmed|23526881]
  • Expression and Regulation

    Operons

    genes
    [gene|BC28167FE175BFD7DBF1B07C54D3512184B95B8F|rapJ]
    description
    [pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • BKE02820 (Δ[gene|BC28167FE175BFD7DBF1B07C54D3512184B95B8F|rapJ]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE02820 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCGGTCTGCCTCCTTCCT, downstream forward: _UP4_TAGGAAATGGCAGAGAACTA
  • BKK02820 (Δ[gene|BC28167FE175BFD7DBF1B07C54D3512184B95B8F|rapJ]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK02820 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCGGTCTGCCTCCTTCCT, downstream forward: _UP4_TAGGAAATGGCAGAGAACTA
  • References

  • 21346797,23526881