SubtiBank SubtiBank
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.


31.58 kDa
protein length
275 aa Sequence Blast
gene length
828 bp Sequence Blast

Genomic Context



  • [category|SW 6|Groups of genes] → [category|SW 6.7|Proteins of unknown function]
  • Gene

    2,768,827 → 2,769,654

    Expression and Regulation


    view in new tab

    Biological materials


  • MGNA-B513 (yrhO::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE27110 (Δ[gene|BC46D5B7ADC6F0F509A78118BA27997BE5050F1E|yrhO]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATATCCTCCAATATAAA, downstream forward: _UP4_TAATGTTTGTCATCTCTTAC
  • BKK27110 (Δ[gene|BC46D5B7ADC6F0F509A78118BA27997BE5050F1E|yrhO]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATATCCTCCAATATAAA, downstream forward: _UP4_TAATGTTTGTCATCTCTTAC