SubtiBank SubtiBank
yrhO
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.

yrhO

unknown
locus
BSU_27110
pI
5.38
mw
31.58 kDa
protein length
275 aa Sequence Blast
gene length
828 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 6|Groups of genes] → [category|SW 6.7|Proteins of unknown function]
  • Gene

    Coordinates
    2,768,827 → 2,769,654

    Expression and Regulation

    Operons

    genes
    [gene|BC46D5B7ADC6F0F509A78118BA27997BE5050F1E|yrhO]
    description
    [Pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • MGNA-B513 (yrhO::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1512 NBRP B. subtilis, Japan]
  • BKE27110 (Δ[gene|BC46D5B7ADC6F0F509A78118BA27997BE5050F1E|yrhO]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE27110 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATATCCTCCAATATAAA, downstream forward: _UP4_TAATGTTTGTCATCTCTTAC
  • BKK27110 (Δ[gene|BC46D5B7ADC6F0F509A78118BA27997BE5050F1E|yrhO]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK27110 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATATCCTCCAATATAAA, downstream forward: _UP4_TAATGTTTGTCATCTCTTAC