SubtiBank SubtiBank
pupG
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

pupG

purine nucleoside phosphorylase
locus
BSU_23490
pI
4.86
mw
28.98 kDa
protein length
271 aa Sequence Blast
gene length
816 bp Sequence Blast
function
purine salvage and interconversion
product
purine nucleoside phosphorylase
essential
no
ec
2.4.2.1
synonyms
punA,pnp,yqkO

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.5|Nucleotide metabolism] → [category|SW 2.5.2|Biosynthesis/ acquisition of nucleotides] → [category|SW 2.5.2.3|Purine salvage and interconversion]
  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.5|Phosphorylation on a Ser residue]
  • Gene

    Coordinates
    2,446,418 → 2,447,233

    The protein

    Catalyzed reaction/ biological activity

  • Purine nucleoside + phosphate = purine + alpha-D-ribose 1-phosphate (according to Swiss-Prot) RNA(n+1) + phosphate = RNA(n) + a nucleoside diphosphate (according to Swiss-Prot)
  • Protein family

  • PNP/MTAP phosphorylase family (single member, according to UniProt)
  • Modification

  • phosphorylation on Ser-28 [Pubmed|17218307]
  • Structure

  • [PDB|3LA8] (from Streptococcus mutans, 57% identity)
  • [SW|Localization]

  • secreted (according to Swiss-Prot)
  • Expression and Regulation

    Operons

    genes
    [gene|9D07E43BF1FFB13CCEAC2B7AAA4EBDFB1079DD74|drm]-[gene|BC6FA7677AAE6BA24530D125007A18056D75DADF|pupG]
    description
    [Pubmed|10537218]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|10537218], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA]: repression, [Pubmed|22900538], in [regulon|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA regulon]
  • regulation

  • induced in the presence of nucleosides (deoxyribose 5-phosphate and ribose 5-phosphate act as molecular inducers) [Pubmed|10537218]
  • view in new tab

    Biological materials

    Mutant

  • BKE23490 (Δ[gene|BC6FA7677AAE6BA24530D125007A18056D75DADF|pupG]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE23490 BGSC], [Pubmed|28189581], upstream reverse: _UP1_TCTGTCCTTCAAGAAACAGT, downstream forward: _UP4_TAAATATGAATCAATGCAGG
  • BKK23490 (Δ[gene|BC6FA7677AAE6BA24530D125007A18056D75DADF|pupG]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK23490 BGSC], [Pubmed|28189581], upstream reverse: _UP1_TCTGTCCTTCAAGAAACAGT, downstream forward: _UP4_TAAATATGAATCAATGCAGG
  • References

  • 10537218,22900538,17218307