SubtiBank SubtiBank
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.


purine nucleoside phosphorylase
28.98 kDa
protein length
271 aa Sequence Blast
gene length
816 bp Sequence Blast
purine salvage and interconversion
purine nucleoside phosphorylase

Genomic Context



  • [category|SW 2|Metabolism] → [category|SW 2.5|Nucleotide metabolism] → [category|SW 2.5.2|Biosynthesis/ acquisition of nucleotides] → [category|SW|Purine salvage and interconversion]
  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.5|Phosphorylation on a Ser residue]
  • Gene

    2,446,418 → 2,447,233

    The protein

    Catalyzed reaction/ biological activity

  • purine 2'-deoxy-D-ribonucleoside + phosphate --> 2-deoxy-α-D-ribose 1-phosphate + purine nucleobase (according to UniProt)
  • Protein family

  • PNP/MTAP phosphorylase family (single member, according to UniProt)
  • Modification

  • phosphorylation on Ser-28 [Pubmed|17218307]
  • Structure

  • [PDB|3LA8] (from Streptococcus mutans, 57% identity)
  • [SW|Localization]

  • secreted (according to Swiss-Prot)
  • Expression and Regulation



    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|10537218], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA]: repression, [Pubmed|22900538], in [regulon|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA regulon]
  • regulation

  • induced in the presence of nucleosides (deoxyribose 5-phosphate and ribose 5-phosphate act as molecular inducers) [Pubmed|10537218]
  • view in new tab

    Biological materials


  • BKE23490 (Δ[gene|BC6FA7677AAE6BA24530D125007A18056D75DADF|pupG]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_TCTGTCCTTCAAGAAACAGT, downstream forward: _UP4_TAAATATGAATCAATGCAGG
  • BKK23490 (Δ[gene|BC6FA7677AAE6BA24530D125007A18056D75DADF|pupG]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_TCTGTCCTTCAAGAAACAGT, downstream forward: _UP4_TAAATATGAATCAATGCAGG
  • References

  • 10537218,22900538,17218307