SubtiBank SubtiBank
ykvQ
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.

ykvQ

similar to chitinase
locus
BSU_13790
pI
8.95
mw
26.47 kDa
protein length
232 aa Sequence Blast
gene length
699 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW 4.2.1.4|Sporulation proteins/ other]
  • [category|SW 6|Groups of genes] → [category|SW 6.6|Poorly characterized/ putative enzymes]
  • Gene

    Coordinates
    1,445,638 → 1,446,336

    The protein

    Protein family

  • [SW|Glycosyl hydrolase 18 family] (according to UniProt)
  • [SW|Domains]

  • [SW|glycoside hydrolase family 18 domain ] (aa 25 to 220)
  • Structure

  • [PDB|5JH8] (from Chromobacterium violaceum, 26% identity)
  • Expression and Regulation

    Operons

    genes
    [gene|FC4C5377EF1D794DCB19D0A8AFE958B84BD9C8BE|ykvP]-[gene|E8311435A86835799E9093DD9CF3733CFFF18DCC|ykzQ]-[gene|BC8CBFF0C2F3C2BEE3275E2CB65D41F2AFC0A1CD|ykvQ]-[gene|4FDAD5E5660EDB346A37C1F41BD8B7B66561E529|ykzR]
    description
    [Pubmed|11011148,22383849]

    sigma factors

  • [protein|24F7FD5C7C3A68BB2760ABB8CBD8FBD65E5FF7D4|SigK]: sigma factor, [Pubmed|11011148,15699190], in [regulon|24F7FD5C7C3A68BB2760ABB8CBD8FBD65E5FF7D4|SigK regulon]
  • regulation

  • expressed late during sporulation in the mother cell ([protein|24F7FD5C7C3A68BB2760ABB8CBD8FBD65E5FF7D4|SigK]) [Pubmed|11011148,15699190]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-A793 (ykvQ::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/793 NBRP B. subtilis, Japan]
  • BKE13790 (Δ[gene|BC8CBFF0C2F3C2BEE3275E2CB65D41F2AFC0A1CD|ykvQ]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE13790 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCTCATAACCCCTTCATC, downstream forward: _UP4_TCTCAAGCCATTCCCCTTTA
  • BKK13790 (Δ[gene|BC8CBFF0C2F3C2BEE3275E2CB65D41F2AFC0A1CD|ykvQ]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK13790 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCTCATAACCCCTTCATC, downstream forward: _UP4_TCTCAAGCCATTCCCCTTTA
  • References

  • 11011148,15699190