SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


membrane protein, may be involved in manganese detoxification
15.83 kDa
protein length
148 aa Sequence Blast
gene length
447 bp Sequence Blast

Genomic Context



  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW|Newly identified sporulation proteins (based on transcription profiling)]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    4,169,166 → 4,169,612

    The protein


  • [PDB|3LLL] (from the mouse, 28% identity) [pubmed|20471395]
  • [SW|Localization]

  • cell membrane (according to UniProt)
  • Expression and Regulation



    regulatory mechanism

  • [regulon|yybP-ykoY motif|yybP-ykoY motif]: antitermination, in the presence of the ligand Mn2+ [Pubmed|25794618], in [regulon|yybP-ykoY motif|yybP-ykoY motif]
  • regulation

  • induced in the presence of Mn2+ ([SW|yybP-ykoY motif]) [Pubmed|25794618]
  • the [SW|RNA switch] RNA is degraded by [protein|872CCB5A49C9000BD95E4B0472556D5F60F7D7A4|RNase Y] [pubmed|29794222]
  • view in new tab

    Biological materials


  • MGNA-B838 (yybP::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE40560 (Δ[gene|BD3A3D84AD3A21B634B8EBAF684B690FE02BD857|yybP]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCTTCAGCCCCCTCATCG, downstream forward: _UP4_TAAGAAAAAGCATCCCGACG
  • BKK40560 (Δ[gene|BD3A3D84AD3A21B634B8EBAF684B690FE02BD857|yybP]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCTTCAGCCCCCTCATCG, downstream forward: _UP4_TAAGAAAAAGCATCCCGACG
  • References

  • 15096624,25794618,25794619,20471395,29794222