SubtiBank SubtiBank
yybP
The papers of the month are back! Check them out! Link here

yybP

membrane protein, may be involved in manganese detoxification
locus
BSU40560
pI
4.24
mw
15.83 kDa
protein length
148 aa Sequence Blast
gene length
444 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW 4.2.1.5|Newly identified sporulation proteins (based on transcription profiling)]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    4,169,166 → 4,169,612

    The protein

    Structure

  • [PDB|3LLL] (from the mouse, 28% identity) [pubmed|20471395]
  • [SW|Localization]

  • cell membrane (according to Swiss-Prot)
  • Expression and Regulation

    Operons

    genes
    [gene|BD3A3D84AD3A21B634B8EBAF684B690FE02BD857|yybP]
    description
    [Pubmed|25794618]

    regulatory mechanism

  • [regulon|yybP-ykoY motif|yybP-ykoY motif]: antitermination, in the presence of the ligand Mn2+ [Pubmed|25794618], in [regulon|yybP-ykoY motif|yybP-ykoY motif]
  • regulation

  • induced in the presence of Mn2+ ([SW|yybP-ykoY motif]) [Pubmed|25794618]
  • the [SW|RNA switch] RNA is degraded by [protein|872CCB5A49C9000BD95E4B0472556D5F60F7D7A4|RNase Y] [pubmed|29794222]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-B838 (yybP::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1837 NBRP B. subtilis, Japan]
  • BKE40560 (Δ[gene|BD3A3D84AD3A21B634B8EBAF684B690FE02BD857|yybP]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE40560 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCTTCAGCCCCCTCATCG, downstream forward: _UP4_TAAGAAAAAGCATCCCGACG
  • BKK40560 (Δ[gene|BD3A3D84AD3A21B634B8EBAF684B690FE02BD857|yybP]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK40560 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCTTCAGCCCCCTCATCG, downstream forward: _UP4_TAAGAAAAAGCATCCCGACG
  • References

  • 15096624,25794618,25794619,20471395,29794222