SubtiBank SubtiBank
cwlQ
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.

cwlQ

cell wall hydrolase
locus
BSU_11570
pI
7.01
mw
18.85 kDa
protein length
181 aa Sequence Blast
gene length
546 bp Sequence Blast
function
cell wall turnover
product
bifunctional enzyme with muramidase and
essential
no
synonyms
yjbJ

Genomic Context

      

categories

  • [category|SW 1|Cellular processes] → [category|SW 1.1|Cell envelope and cell division] → [category|SW 1.1.3|Cell wall degradation/ turnover] → [category|SW 1.1.3.1|Autolysis]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    1,235,163 → 1,235,708

    The protein

    Catalyzed reaction/ biological activity

  • bifunctional cell wall hydrolase with muramidase and soluble-lytic transglycosylase activities [Pubmed|20609359]
  • Protein family

  • transglycosylase Slt family (together with [protein|F43DC974DC71CB5F82DBD9B9D5ACEB49131772DB|CwlP]) (according to UniProt)
  • Structure

  • [PDB|5OHU] (from Pseudomonas aeruginosa, corresponds to aa 62 ... 177, 37% identity) [pubmed|29632171]
  • [SW|Localization]

  • cell membrane (according to UniProt)
  • Expression and Regulation

    Operons

    genes
    [gene|BD3C36B63C5D88FDBACFB18849F3DA863F38383F|cwlQ]
    description
    [Pubmed|15033535]

    sigma factors

  • [protein|7024E4162A6D827069F882FDEACA696EBC05DD40|SigD]: sigma factor, [Pubmed|15033535], in [regulon|7024E4162A6D827069F882FDEACA696EBC05DD40|SigD regulon]
  • view in new tab

    genes
    [gene|38EABA6E1998FF194B6EEB6ACDC800615E998BD3|yjbK]-[gene|BD3C36B63C5D88FDBACFB18849F3DA863F38383F|cwlQ]
    description
    [Pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • MGNA-B156 (yjbJ::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1155 NBRP B. subtilis, Japan]
  • BKE11570 (Δ[gene|BD3C36B63C5D88FDBACFB18849F3DA863F38383F|cwlQ]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE11570 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGCTGAGCGGGCTTGGCG, downstream forward: _UP4_TAACCAGAGGTGCTCTTTCC
  • BKK11570 (Δ[gene|BD3C36B63C5D88FDBACFB18849F3DA863F38383F|cwlQ]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK11570 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGCTGAGCGGGCTTGGCG, downstream forward: _UP4_TAACCAGAGGTGCTCTTTCC
  • References

  • 20609359,15033535,29632171