SubtiBank SubtiBank
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.


17.60 kDa
protein length
155 aa Sequence Blast
gene length
468 bp Sequence Blast

Genomic Context



  • [category|SW 6|Groups of genes] → [category|SW 6.7|Proteins of unknown function]
  • Gene

    3,476,043 → 3,476,510

    The protein


  • [SW|N-acetyltransferase domain] (aa 6-155) (according to UniProt)
  • Structure

  • [PDB|1YVK] (complex with CoA)
  • Expression and Regulation


    view in new tab

    Biological materials


  • MGNA-A462 (yvbK::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE33890 (Δ[gene|BDE9DDD852666EF28CBBAA5077F52653C9D15351|yvbK]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTCCACCTTTTTAGTCTG, downstream forward: _UP4_TGAAAGCATAAAAAAGCCGC
  • BKK33890 (Δ[gene|BDE9DDD852666EF28CBBAA5077F52653C9D15351|yvbK]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTCCACCTTTTTAGTCTG, downstream forward: _UP4_TGAAAGCATAAAAAAGCCGC
  • References

  • 22383849