SubtiBank SubtiBank
yvbK
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yvbK

unknown
locus
BSU_33890
pI
4.55
mw
17.60 kDa
protein length
155 aa Sequence Blast
gene length
468 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 6|Groups of genes] → [category|SW 6.7|Proteins of unknown function]
  • Gene

    Coordinates
    3,476,043 → 3,476,510

    The protein

    [SW|Domains]

  • [SW|N-acetyltransferase domain] (aa 6-155) (according to UniProt)
  • Structure

  • [PDB|1YVK] (complex with CoA)
  • Expression and Regulation

    Operons

    genes
    [gene|BDE9DDD852666EF28CBBAA5077F52653C9D15351|yvbK]
    description
    [Pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • MGNA-A462 (yvbK::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/462 NBRP B. subtilis, Japan]
  • BKE33890 (Δ[gene|BDE9DDD852666EF28CBBAA5077F52653C9D15351|yvbK]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE33890 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTCCACCTTTTTAGTCTG, downstream forward: _UP4_TGAAAGCATAAAAAAGCCGC
  • BKK33890 (Δ[gene|BDE9DDD852666EF28CBBAA5077F52653C9D15351|yvbK]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK33890 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTCCACCTTTTTAGTCTG, downstream forward: _UP4_TGAAAGCATAAAAAAGCCGC
  • References

  • 22383849