SubtiBank SubtiBank
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.


magnesium efflux pump, mutation suppresses defects in 70 S ribosome formation
49.69 kDa
protein length
444 aa Sequence Blast
gene length
1335 bp Sequence Blast
export of magnesium
magnesium efflux pump

Genomic Context



  • [category|SW 1|Cellular processes] → [category|SW 1.3|Homeostasis] → [category|SW 1.3.1|Metal ion homeostasis (K, Na, Ca, Mg)] → [category|SW|Magnesium uptake/ efflux]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    1,032,063 → 1,033,397

    Phenotypes of a mutant

  • suppression of the growth defects of [gene|44D4CE353E1E532664A508CBE8B49AC8BB861B53|rplA] and [gene|5F3933197343FBBDCBD42B408837F8EEF0A0BEBD|rplW] mutants [pubmed|29967120]
  • partial suppression of sporulation frequency of a [gene|44D4CE353E1E532664A508CBE8B49AC8BB861B53|rplA] mutant [pubmed|29967120]
  • suppresses the Mn2+ sensitivity of a [gene|FF34DC303E8A7C9FAA205A6C2924961963B14EB1|mntR] [gene|353DADE8E57A0F1895CCEB62701F9273EEB5EB45|mntH] double mutant [pubmed|31964700]
  • increased tolerance to Mn2+ and Co2+ [pubmed|31964700]
  • resistant to high Mg2+ concentrations [pubmed|31964700]
  • The protein

    Protein family

  • [SW|UPF0053 family](according to UniProt)
  • Paralogous protein(s)

  • [protein|E53B8D437B848B637AEC8C1BB9428EC8B6EB280E|YqhB], [protein|45F03AB13292BBF0554785C7C02FE29033EDD742|YrkA], [protein|A459410312A926365B45CEB4694DE399B38820A2|YugS], [protein|B2E9D026B668C8530C406353E3400059388566FB|YhdT]
  • [SW|Domains]

  • [SW|CNNM transmembrane domain] (aa 1-201) (according to UniProt)
  • [SW|DUF21 domain] (aa 5-201)
  • 2 [SW|CBS domain]s (aa 220-282, aa 284-344) (according to UniProt)
  • Structure

  • [PDB|4HG0] (CorC from E. coli, corresponds to the [SW|CBS domain]s and the C-terminal transporter-associated domain)
  • [SW|Localization]

  • cell membrane (according to UniProt)
  • Expression and Regulation




  • threefold induced in the presence of high Mg2+ concentrations [Pubmed|31964700]
  • view in new tab

    Biological materials


  • HB24928 (Δ[gene|BE0777DE7C40825D4DB7252EA84AAB3892578529|mpfA]), available in [SW|John Helmann]'s and [SW|Jörg Stülke]'s labs
  • MGNA-A696 (yhdP::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE09550 (Δ[gene|BE0777DE7C40825D4DB7252EA84AAB3892578529|mpfA]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAATTAGAACCTTCACTCTA, downstream forward: _UP4_TAATAAGAAAAGCACCTTGT
  • BKK09550 (Δ[gene|BE0777DE7C40825D4DB7252EA84AAB3892578529|mpfA]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAATTAGAACCTTCACTCTA, downstream forward: _UP4_TAATAAGAAAAGCACCTTGT
  • Expression vectors

  • pGP2931 (N-terminal His-tag, purification from ''E. coli'', in [SW|pWH844]), available in [SW|Jörg Stülke]'s lab
  • References

  • 10960106,22383849,25182490,27933050,29967120,31415562,31864811,31964700