SubtiBank SubtiBank
mpfA
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.

mpfA

magnesium efflux pump, mutation suppresses defects in 70 S ribosome formation
locus
BSU_09550
pI
4.40
mw
49.69 kDa
protein length
444 aa Sequence Blast
gene length
1335 bp Sequence Blast
function
export of magnesium
product
magnesium efflux pump
essential
no
synonyms
yhdP

Genomic Context

      

categories

  • [category|SW 1|Cellular processes] → [category|SW 1.3|Homeostasis] → [category|SW 1.3.1|Metal ion homeostasis (K, Na, Ca, Mg)] → [category|SW 1.3.1.1|Magnesium uptake/ efflux]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    1,032,063 → 1,033,397

    Phenotypes of a mutant

  • suppression of the growth defects of [gene|44D4CE353E1E532664A508CBE8B49AC8BB861B53|rplA] and [gene|5F3933197343FBBDCBD42B408837F8EEF0A0BEBD|rplW] mutants [pubmed|29967120]
  • partial suppression of sporulation frequency of a [gene|44D4CE353E1E532664A508CBE8B49AC8BB861B53|rplA] mutant [pubmed|29967120]
  • suppresses the Mn2+ sensitivity of a [gene|FF34DC303E8A7C9FAA205A6C2924961963B14EB1|mntR] [gene|353DADE8E57A0F1895CCEB62701F9273EEB5EB45|mntH] double mutant [pubmed|31964700]
  • increased tolerance to Mn2+ and Co2+ [pubmed|31964700]
  • resistant to high Mg2+ concentrations [pubmed|31964700]
  • The protein

    Protein family

  • [SW|UPF0053 family](according to UniProt)
  • Paralogous protein(s)

  • [protein|E53B8D437B848B637AEC8C1BB9428EC8B6EB280E|YqhB], [protein|45F03AB13292BBF0554785C7C02FE29033EDD742|YrkA], [protein|A459410312A926365B45CEB4694DE399B38820A2|YugS], [protein|B2E9D026B668C8530C406353E3400059388566FB|YhdT]
  • [SW|Domains]

  • [SW|CNNM transmembrane domain] (aa 1-201) (according to UniProt)
  • [SW|DUF21 domain] (aa 5-201)
  • 2 [SW|CBS domain]s (aa 220-282, aa 284-344) (according to UniProt)
  • Structure

  • [PDB|4HG0] (CorC from E. coli, corresponds to the [SW|CBS domain]s and the C-terminal transporter-associated domain)
  • [SW|Localization]

  • cell membrane (according to UniProt)
  • Expression and Regulation

    Operons

    genes
    [gene|EDFAF3AF6F2E7578733D5BF0295AD614070453F4|yhdQ]-[gene|BE0777DE7C40825D4DB7252EA84AAB3892578529|mpfA]
    description
    [Pubmed|22383849]

    regulation

  • threefold induced in the presence of high Mg2+ concentrations [Pubmed|31964700]
  • view in new tab

    Biological materials

    Mutant

  • HB24928 (Δ[gene|BE0777DE7C40825D4DB7252EA84AAB3892578529|mpfA]), available in [SW|John Helmann]'s and [SW|Jörg Stülke]'s labs
  • MGNA-A696 (yhdP::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/696 NBRP B. subtilis, Japan]
  • BKE09550 (Δ[gene|BE0777DE7C40825D4DB7252EA84AAB3892578529|mpfA]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE09550 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAATTAGAACCTTCACTCTA, downstream forward: _UP4_TAATAAGAAAAGCACCTTGT
  • BKK09550 (Δ[gene|BE0777DE7C40825D4DB7252EA84AAB3892578529|mpfA]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK09550 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAATTAGAACCTTCACTCTA, downstream forward: _UP4_TAATAAGAAAAGCACCTTGT
  • Expression vectors

  • pGP2931 (N-terminal His-tag, purification from ''E. coli'', in [SW|pWH844]), available in [SW|Jörg Stülke]'s lab
  • References

  • 10960106,22383849,25182490,27933050,29967120,31415562,31864811,31964700