SubtiBank SubtiBank
yerB
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.

yerB

[protein|search|PcrA ]interaction protein
locus
BSU_06570
pI
8.16
mw
36.81 kDa
protein length
331 aa Sequence Blast
gene length
996 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 5|Prophages and mobile genetic elements] → [category|SW 5.2|Mobile genetic elements] → [category|SW 5.2.2|Additional genes]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.8|Phosphorylation on either a Ser, Thr or Tyr residue]
  • Gene

    Coordinates
    715,433 → 716,428

    The protein

    Modification

  • phosphorylation on (Thr-97 OR Ser-103) [Pubmed|17218307]
  • Structure

  • [PDB|2PSB]
  • [SW|Localization]

  • cell membrane (according to UniProt), Polar (Septum) [Pubmed|16479537]
  • Expression and Regulation

    Operons

    genes
    [gene|BE1F7BA77CE8B6A1A2D22F31421C27F2E954816A|yerB]-[gene|B948BD67148DC53B371E6748347982067CE28C36|yerC]
    description
    [pubmed|22383849]

    regulatory mechanism

  • [protein|2C54FE2ADC82FF414D732018C90649D477A925AD|Spo0A]: activation, [Pubmed|14651647], in [regulon|2C54FE2ADC82FF414D732018C90649D477A925AD|Spo0A regulon]
  • regulation

  • expressed under conditions that trigger sporulation ([SW|Spo0A]) [Pubmed|14651647]
  • view in new tab

    genes
    [gene|E20A5429BCD8719A403229AFB200225EA14EE2DB|yerA]-[gene|BE1F7BA77CE8B6A1A2D22F31421C27F2E954816A|yerB]-[gene|B948BD67148DC53B371E6748347982067CE28C36|yerC]
    description
    [pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • MGNA-A912 (yerB::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/912 NBRP B. subtilis, Japan]
  • BKE06570 (Δ[gene|BE1F7BA77CE8B6A1A2D22F31421C27F2E954816A|yerB]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE06570 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATGTCGGCTCCCTGCTC, downstream forward: _UP4_AGTAAAGGAGAAGGTGTGTA
  • BKK06570 (Δ[gene|BE1F7BA77CE8B6A1A2D22F31421C27F2E954816A|yerB]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK06570 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATGTCGGCTCCCTGCTC, downstream forward: _UP4_AGTAAAGGAGAAGGTGTGTA
  • References

  • 14651647,16479537,17218307,12073041