SubtiBank SubtiBank
yrvJ
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.

yrvJ

similar to N-acetylmuramoyl-L-alanine amidase
locus
BSU_27580
pI
5.19
mw
55.33 kDa
protein length
518 aa Sequence Blast
gene length
1557 bp Sequence Blast
function
cell wall metabolism
product
peptidoglycan hydrolase
essential
no
ec
3.5.1.28
synonyms

Genomic Context

      

categories

  • [category|SW 1|Cellular processes] → [category|SW 1.1|Cell envelope and cell division] → [category|SW 1.1.6|Cell wall/ other/ based on similarity]
  • Gene

    Coordinates
    2,818,494 → 2,820,050

    The protein

    Catalyzed reaction/ biological activity

  • Hydrolyzes the link between N-acetylmuramoyl residues and L-amino acid residues in certain cell-wall glycopeptides (according to UniProt)
  • Protein family

  • [SW|N-acetylmuramoyl-L-alanine amidase 3 family] (according to UniProt)
  • [SW|Domains]

  • contains an amidase_3 domain (like [protein|5CDF32B0E78F01C696364555E3F0BC8DF2AA2089|CwlC], [protein|B09FB626274B81F00A4FB42D188E089095343182|CwlD], [protein|6A21293823151C6980BF52B31A4B249A8440F2E1|LytC], [protein|0AD75864794E597AA9160969ADE6FE0C7ED07B9F|YqiI])
  • [SW|MurNAc-LAA domain] (aa 346-514) (according to UniProt)
  • 4 [SW|SH3b domain]s (aa 29-92, aa 102-164, aa 181-243, aa 258-320) (according to UniProt)
  • Expression and Regulation

    Operons

    genes
    [gene|BE34A9CE3AF99E8880FC24E34E5D79A1627260AE|yrvJ]
    description
    [Pubmed|9383190]
    view in new tab

    Biological materials

    Mutant

  • BKE27580 (Δ[gene|BE34A9CE3AF99E8880FC24E34E5D79A1627260AE|yrvJ]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE27580 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTGTGTCCTCCTTTCTGA, downstream forward: _UP4_TAAAAAAAGCTGCCTTTTGG
  • BKK27580 (Δ[gene|BE34A9CE3AF99E8880FC24E34E5D79A1627260AE|yrvJ]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK27580 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTGTGTCCTCCTTTCTGA, downstream forward: _UP4_TAAAAAAAGCTGCCTTTTGG
  • References

  • 9383190