SubtiBank SubtiBank
ytzE
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

ytzE

similar to transcriptional regulator ([SW|DeoR family])
locus
BSU_30020
pI
10.52
mw
8.36 kDa
protein length
gene length
222 bp Sequence Blast
function
unknown
product
putative transcription factor
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW 3.4.2.6|Transcription factor/ other/ based on similarity]
  • Gene

    Coordinates
    3,072,401 → 3,072,622

    The protein

    Structure

  • [PDB|4HX4] ([protein|FF34DC303E8A7C9FAA205A6C2924961963B14EB1|MntR], 26% identity) [pubmed|23298157]
  • Biological materials

    Mutant

  • BKE30020 (Δ[gene|BE4AE7892B544A974D6BA5BD5A5D5BE631699AAA|ytzE]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE30020 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAAAAAACCACTCCCTATCA, downstream forward: _UP4_TAAATTGAAAATTACATAGG
  • BKK30020 (Δ[gene|BE4AE7892B544A974D6BA5BD5A5D5BE631699AAA|ytzE]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK30020 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAAAAAACCACTCCCTATCA, downstream forward: _UP4_TAAATTGAAAATTACATAGG
  • GP2583 (Δ[gene|BE4AE7892B544A974D6BA5BD5A5D5BE631699AAA|ytzE]::tet comIQ12L) (in DK1042) available at [SW|Jörg Stülke]'s lab
  • References

    Research papers

  • 23298157