SubtiBank SubtiBank
recR
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

recR

required for the formation of [protein|A44D4677FB70BE8F554BF1001A500F817C7DA95F|RecA] DNA repair centers
locus
BSU_00210
pI
5.30
mw
21.83 kDa
protein length
198 aa Sequence Blast
gene length
597 bp Sequence Blast
function
[category|SW 3.1.5|DNA repair/ recombination]
product
formation of [protein|A44D4677FB70BE8F554BF1001A500F817C7DA95F|RecA] DNA repair centers
essential
no
synonyms
recM

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.1|Genetics] → [category|SW 3.1.5|DNA repair/ recombination]
  • [category|SW 3|Information processing] → [category|SW 3.1|Genetics] → [category|SW 3.1.5|DNA repair/ recombination] → [category|SW 3.1.5.6|Other proteins]
  • Gene

    Coordinates
    28,867 → 29,463

    Phenotypes of a mutant

  • drastically reduced survival of mature dormant spores after exposure to ultrahigh vacuum desiccation and ionizing radiation that induce single strand (ss) DNA nicks and double-strand breaks (DSBs) [Pubmed|24285298]
  • The protein

    Catalyzed reaction/ biological activity

  • required for the formation of [protein|A44D4677FB70BE8F554BF1001A500F817C7DA95F|RecA] DNA repair centers (together with [protein|80E6F156764FF30300D034EE6FB44F2DB8338AF3|RecO]) [Pubmed|24891441]
  • Protein family

  • RecR family (single member, according to UniProt)
  • [SW|Domains]

  • [SW|TOPRIM domain] (aa 80-175) [Pubmed|9722641]
  • Structure

  • [PDB|2V1C] (the [protein|BEBAF1EB53EBB3E7558BB5FE73C418B50000FA29|RecR]-[protein|80E6F156764FF30300D034EE6FB44F2DB8338AF3|RecO] complex from ''Deinococcus radiodurans'', [protein|BEBAF1EB53EBB3E7558BB5FE73C418B50000FA29|RecR]: 52% identity, 78% similarity, [protein|80E6F156764FF30300D034EE6FB44F2DB8338AF3|RecO]: 30%/ 58%) [Pubmed|17581636]
  • [SW|Localization]

  • cytoplasm (homogeneous) [Pubmed|16479537]
  • Expression and Regulation

    Operons

    genes
    [gene|73D063EDC412F7F28DA27C986ECCCD1C4A1F6618|dnaX]-[gene|9AFCEFE83560B1E2B1FFD7CFD2E4F17FAE137889|yaaK]-[gene|BEBAF1EB53EBB3E7558BB5FE73C418B50000FA29|recR]-[gene|C5127208E7562F09249112240F0BE8C582B2E5AD|yaaL]-[gene|CB5D3A2E5BEE336539BEB2D7C5D9C3A63C78FD01|bofA]
    description
    [Pubmed|22383849]
    view in new tab

    additional information

  • the mRNA is very stable (> 15 min) [pubmed|12884008]
  • Biological materials

    Mutant

  • BKE00210 (Δ[gene|BEBAF1EB53EBB3E7558BB5FE73C418B50000FA29|recR]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE00210 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTTCTTTTATCCCCCTA, downstream forward: _UP4_TTGTAAGGAGGAAAAAGCGA
  • BKK00210 (Δ[gene|BEBAF1EB53EBB3E7558BB5FE73C418B50000FA29|recR]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK00210 BGSC] and in [SW|Jörg Stülke]'s lab, [Pubmed|28189581], upstream reverse: _UP1_CATGTTCTTTTATCCCCCTA, downstream forward: _UP4_TTGTAAGGAGGAAAAAGCGA
  • References

    Reviews

  • 22933559,32286623
  • Original publications

  • 12884008,17581636,16479537,24285298,24285298,24891441,9157236,9108290,8419343,9722641