SubtiBank SubtiBank
The papers of the month are back! Check them out! Link here


transcriptional activator of arginine utilization operons
52.01 kDa
protein length
461 aa Sequence Blast
gene length
1383 bp Sequence Blast
transcriptional activator of arginine utilization operons
transcriptional activator

Genomic Context



  • [category|SW 2|Metabolism] → [category|SW 2.3|Amino acid/ nitrogen metabolism] → [category|SW 2.3.2|Utilization of amino acids] → [category|SW|Utilization of arginine/ ornithine]
  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW|Transcription factors/ other]
  • Gene

    4,145,747 → 4,147,132

    The protein

    Catalyzed reaction/ biological activity

  • transcription activation at [protein|1118A21CC581B0470EC6E7C178F2523CDCA70F93|SigL]-dependent promoters of [gene|69838717DC6BB27864D88C282BF5BC7CC558BFD7|rocABC], [gene|617FE9E40E8822D58B0446128585CB6CA05A50C6|rocDEF], and [gene|56CBEBCFEF5CFB4A0175498338C7AF2F45EAA3E3|rocG]
  • Protein family

  • [protein|1118A21CC581B0470EC6E7C178F2523CDCA70F93| Sigma-54] interacting transcription activator
  • [SW|Transcription factors activating transcription at SigL-dependent promoters]
  • [SW|Domains]

  • [protein|1118A21CC581B0470EC6E7C178F2523CDCA70F93| Sigma-54] factor interaction domain (143–372)
  • 2x nucleotid-binding domain (171–178),(233–242)
  • HTH motif (434–453)
  • [SW|PAS domain]
  • [SW|Cofactors]

  • ornithine or citrulline are required for RocR-dependent transcription activation [ PubMed]
  • additional information

  • information on binding sites can be found in the [ PRODORIC2 database]
  • Expression and Regulation


    (according to [ DBTBS]) null

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [PubMed|7540694], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|BEE6F16D6A5BBC7FED9E8EB5FA6A94BBF932BBDA|RocR]: autorepression, [Pubmed|2548995], in [regulon|BEE6F16D6A5BBC7FED9E8EB5FA6A94BBF932BBDA|RocR regulon]
  • [protein|D267AF38B0CF107042326E9B8F3DD3C9C85840E4|LexA]: autorepression, in [regulon|D267AF38B0CF107042326E9B8F3DD3C9C85840E4|LexA regulon]
  • regulation

  • autoregulation by [protein|search|RocR] [ 7540694 PubMed]
  • view in new tab

    Biological materials


  • GP2312 (Δ[gene|BEE6F16D6A5BBC7FED9E8EB5FA6A94BBF932BBDA|rocR]::''tet'', available in [SW|Jörg Stülke]'s lab)
  • QB5533 (aphA3), from [SW|Michel Debarbouille], available in [SW|Jörg Stülke]'s lab
  • 1A911 ( ''rocR''::''kan''), [Pubmed|16585774], available at [ BGSC]
  • BKE40350 (Δ[gene|BEE6F16D6A5BBC7FED9E8EB5FA6A94BBF932BBDA|rocR]::''erm'', available in the BGSC, in [SW|Fabian Commichau]'s, and in [SW|Jörg Stülke]'s lab) [pubmed|28189581]
  • BKE40350 (Δ[gene|BEE6F16D6A5BBC7FED9E8EB5FA6A94BBF932BBDA|rocR]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACTGTATGAACCTCCCTCA, downstream forward: _UP4_CAATATCGGCTGAAGAAATT
  • BKK40350 (Δ[gene|BEE6F16D6A5BBC7FED9E8EB5FA6A94BBF932BBDA|rocR]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACTGTATGAACCTCCCTCA, downstream forward: _UP4_CAATATCGGCTGAAGAAATT
  • Labs working on this gene/protein

  • [SW|Michel Debarbouille], Pasteur Institute, Paris, France [ Homepage]
  • References

  • 12634342,8113162,9194709,21965396,23869754,21906631