SubtiBank SubtiBank
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.


transcriptional activator of arginine utilization operons
52.01 kDa
protein length
461 aa Sequence Blast
gene length
1383 bp Sequence Blast
transcriptional activator of arginine utilization operons
transcriptional activator

Genomic Context



  • [category|SW 2|Metabolism] → [category|SW 2.3|Amino acid/ nitrogen metabolism] → [category|SW 2.3.2|Utilization of amino acids] → [category|SW|Utilization of arginine/ ornithine]
  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW|Transcription factors/ other]
  • Gene

    4,145,747 → 4,147,132

    The protein

    Catalyzed reaction/ biological activity

  • transcription activation at [protein|1118A21CC581B0470EC6E7C178F2523CDCA70F93|SigL]-dependent promoters of [gene|69838717DC6BB27864D88C282BF5BC7CC558BFD7|rocABC], [gene|617FE9E40E8822D58B0446128585CB6CA05A50C6|rocDEF], and [gene|56CBEBCFEF5CFB4A0175498338C7AF2F45EAA3E3|rocG]
  • Protein family

  • [protein|1118A21CC581B0470EC6E7C178F2523CDCA70F93| Sigma-54] interacting transcription activator
  • [SW|Transcription factors activating transcription at SigL-dependent promoters]
  • [SW|Domains]

  • [protein|1118A21CC581B0470EC6E7C178F2523CDCA70F93| Sigma-54] factor interaction domain (143–372)
  • 2x nucleotid-binding domain (171–178),(233–242)
  • HTH motif (434–453)
  • [SW|PAS domain]
  • [SW|Cofactors]

  • ornithine or citrulline are required for RocR-dependent transcription activation [ PubMed]
  • Structure

  • [PDB|1OJL] (from Salmonella typhimurium, corresponds to aa 143 ... 454, 41% identity) [pubmed|16005641]
  • additional information

  • information on binding sites can be found in the [ PRODORIC2 database]
  • Expression and Regulation



    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [PubMed|7540694], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|BEE6F16D6A5BBC7FED9E8EB5FA6A94BBF932BBDA|RocR]: autorepression, [Pubmed|2548995], in [regulon|BEE6F16D6A5BBC7FED9E8EB5FA6A94BBF932BBDA|RocR regulon]
  • [protein|D267AF38B0CF107042326E9B8F3DD3C9C85840E4|LexA]: autorepression, in [regulon|D267AF38B0CF107042326E9B8F3DD3C9C85840E4|LexA regulon]
  • regulation

  • autoregulation by [protein|BEE6F16D6A5BBC7FED9E8EB5FA6A94BBF932BBDA|RocR] [ 7540694 PubMed]
  • view in new tab

    Biological materials


  • GP2312 (Δ[gene|BEE6F16D6A5BBC7FED9E8EB5FA6A94BBF932BBDA|rocR]::''tet'', available in [SW|Jörg Stülke]'s lab)
  • QB5533 (aphA3), from [SW|Michel Debarbouille], available in [SW|Jörg Stülke]'s lab
  • 1A911 ( ''rocR''::''kan''), [Pubmed|16585774], available at [ BGSC]
  • BKE40350 (Δ[gene|BEE6F16D6A5BBC7FED9E8EB5FA6A94BBF932BBDA|rocR]::''erm'', available in the BGSC, in [SW|Fabian Commichau]'s, and in [SW|Jörg Stülke]'s lab) [pubmed|28189581]
  • BKE40350 (Δ[gene|BEE6F16D6A5BBC7FED9E8EB5FA6A94BBF932BBDA|rocR]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACTGTATGAACCTCCCTCA, downstream forward: _UP4_CAATATCGGCTGAAGAAATT
  • BKK40350 (Δ[gene|BEE6F16D6A5BBC7FED9E8EB5FA6A94BBF932BBDA|rocR]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACTGTATGAACCTCCCTCA, downstream forward: _UP4_CAATATCGGCTGAAGAAATT
  • labs

  • [SW|Michel Debarbouille], Pasteur Institute, Paris, France [ Homepage]
  • References

  • 12634342,8113162,9194709,21965396,23869754,21906631,16005641