SubtiBank SubtiBank
yxaM
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

yxaM

similar to antibiotic resistance protein
locus
BSU_39930
pI
8.31
mw
44.59 kDa
protein length
399 aa Sequence Blast
gene length
1200 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.14|Resistance against toxins/ antibiotics/ based on similarity]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    4,101,166 → 4,102,365

    The protein

    Protein family

  • [SW|major facilitator superfamily] (according to UniProt)
  • [SW|Localization]

  • cell membrane (according to UniProt)
  • Expression and Regulation

    Operons

    genes
    [gene|787BB72119DB1321A8281D7C46FED28CAEDBC97C|yxbB]-[gene|88B01CC87394AEE693A98574F9343EBF99F0D60E|yxbA]-[gene|A15368CD02487EBC1AF999FED34672E38167BCB2|yxnB]-[gene|9446D9C88CBBBC5A08495D8AA49A92A9F47F2C9B|asnH]-[gene|BF0E188249161B3CC24D223FDD48B820EBED8F55|yxaM]
    description
    [Pubmed|10746760]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|20185509], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|CodY]: repression, [Pubmed|12618455], in [regulon|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|CodY regulon]
  • [protein|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB]: repression, [Pubmed|15101989], in [regulon|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB regulon]
  • regulation

  • repressed by glucose (8-fold) [Pubmed|12850135]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-B688 (yxaM::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1687 NBRP B. subtilis, Japan]
  • BKE39930 (Δ[gene|BF0E188249161B3CC24D223FDD48B820EBED8F55|yxaM]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE39930 BGSC], [Pubmed|28189581], upstream reverse: _UP1_TGCGGAAAACGAATAAAAGA, downstream forward: _UP4_TAAATGTTTTGTATCACAGT
  • BKK39930 (Δ[gene|BF0E188249161B3CC24D223FDD48B820EBED8F55|yxaM]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK39930 BGSC], [Pubmed|28189581], upstream reverse: _UP1_TGCGGAAAACGAATAAAAGA, downstream forward: _UP4_TAAATGTTTTGTATCACAGT
  • References

  • 10746760,10498721,12618455,15101989