SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


transcriptional activator ([SW|AraC family]) of the rhamnogalacturonan operon
87.56 kDa
protein length
761 aa Sequence Blast
gene length
2286 bp Sequence Blast
regulation of pectin utilization
transcriptional activator of the rhamnogalacturonan operon

Genomic Context



  • [category|SW 2|Metabolism] → [category|SW 2.2|Carbon metabolism] → [category|SW 2.2.2|Utilization of specific carbon sources] → [category|SW|Utilization of pectin]
  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW|Transcription factors/ other]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    765,838 → 768,123

    The protein

    Protein family

  • [SW|AraC family]
  • [SW|Domains]

  • [protein|29B793660E4D30C0656248F3EF403FEF76FB9025|HPr]-binding domain: aa 406 - 510 [Pubmed|19651770]
  • [SW|HTH araC/xylS-type domain] (aa 659-756) (according to UniProt)
  • Effectors of protein activity

  • interaction with [protein|29B793660E4D30C0656248F3EF403FEF76FB9025|HPr(His)-P]]] (occurs in the absence of preferred carbon sources) stimulates YesS activity [Pubmed|19651770]
  • [SW|Localization]

  • cell membrane (according to UniProt)
  • Expression and Regulation



    regulatory mechanism

  • [protein|BF0E202739BFD461E418655ECD9C3425AC556FA3|RhgR]: activation, [Pubmed|19651770], in [regulon|BF0E202739BFD461E418655ECD9C3425AC556FA3|RhgR regulon]
  • regulation

  • induced by pectin ([protein|search|RhgR]) [Pubmed|19651770]
  • view in new tab

    Biological materials


  • MGNA-B450 (yesS::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE07010 (Δ[gene|BF0E202739BFD461E418655ECD9C3425AC556FA3|rhgR]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCCCTCTCCCCCCGCCGC, downstream forward: _UP4_GAAACGCCGTGAAAGGAGAG
  • BKK07010 (Δ[gene|BF0E202739BFD461E418655ECD9C3425AC556FA3|rhgR]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCCCTCTCCCCCCGCCGC, downstream forward: _UP4_GAAACGCCGTGAAAGGAGAG
  • References

  • 19651770,17449691,21630458,24391637