SubtiBank SubtiBank
The papers of the month are back! Check them out! Link here


transcriptional activator (AraC family) of the rhamnogalacturonan operon
87.56 kDa
protein length
761 aa Sequence Blast
gene length
2283 bp Sequence Blast
regulation of pectin utilization
transcriptional activator of the rhamnogalacturonan operon

Genomic Context



  • [category|SW 2|Metabolism] → [category|SW 2.2|Carbon metabolism] → [category|SW 2.2.2|Utilization of specific carbon sources] → [category|SW|Utilization of pectin]
  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW|Transcription factors/ other]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    765,838 → 768,123

    The protein

    Protein family

  • [SW|AraC family]
  • [SW|Domains]

  • [protein|29B793660E4D30C0656248F3EF403FEF76FB9025|HPr]]]-binding domain: aa 406 - 510 [Pubmed|19651770]
  • Effectors of protein activity

  • interaction with [protein|29B793660E4D30C0656248F3EF403FEF76FB9025|HPr(His)-P]]] (occurs in the absence of preferred carbon sources) stimulates YesS activity [Pubmed|19651770]
  • [SW|Localization]

  • cell membrane (according to Swiss-Prot)
  • Expression and Regulation



    regulatory mechanism

  • [protein|BF0E202739BFD461E418655ECD9C3425AC556FA3|RhgR]: activation, [Pubmed|19651770], in [regulon|BF0E202739BFD461E418655ECD9C3425AC556FA3|RhgR regulon]
  • regulation

  • induced by pectin ([protein|search|RhgR]) [Pubmed|19651770]
  • view in new tab

    Biological materials


  • MGNA-B450 (yesS::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE07010 (Δ[gene|BF0E202739BFD461E418655ECD9C3425AC556FA3|rhgR]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCCCTCTCCCCCCGCCGC, downstream forward: _UP4_GAAACGCCGTGAAAGGAGAG
  • BKK07010 (Δ[gene|BF0E202739BFD461E418655ECD9C3425AC556FA3|rhgR]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCCCTCTCCCCCCGCCGC, downstream forward: _UP4_GAAACGCCGTGAAAGGAGAG
  • References

  • 19651770,17449691,21630458,24391637