SubtiBank SubtiBank
sscA
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.

sscA

small spore protein
locus
BSU_09958
pI
5.27
mw
2.98 kDa
protein length
gene length
function
spore coat assembly
product
small spore protein
essential
no
synonyms
yhzE

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW 4.2.1.4|Sporulation proteins/ other]
  • Gene

    Coordinates
    1,071,402 → 1,071,488

    Phenotypes of a mutant

  • poor [SW|germination]
  • The protein

    Protein family

  • [SW|SscA family] (according to UniProt)
  • Expression and Regulation

    Operons

    genes
    [gene|BF6DA9F822CB6AC907E53BC8745D411245827820|sscA]
    description
    [Pubmed|21670523]

    sigma factors

  • [protein|24F7FD5C7C3A68BB2760ABB8CBD8FBD65E5FF7D4|SigK]: sigma factor, [Pubmed|21670523], in [regulon|24F7FD5C7C3A68BB2760ABB8CBD8FBD65E5FF7D4|SigK regulon]
  • regulatory mechanism

  • [protein|19228BAD44E6DA3DE908DC390FDF628C18D94E65|GerE]: activation, [Pubmed|21670523], in [regulon|19228BAD44E6DA3DE908DC390FDF628C18D94E65|GerE regulon]
  • regulation

  • expressed late during sporulation in the mother cell ([protein|search|SigK], [protein|search|GerE]) [Pubmed|21670523]
  • view in new tab

    additional information

  • the mRNA belongs to the 46 most abundant mRNA species in dormant spores [pubmed|30782632]
  • Biological materials

    Mutant

  • BKE09958 (Δ[gene|BF6DA9F822CB6AC907E53BC8745D411245827820|sscA]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE09958 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTTACATACCTCCTTTT, downstream forward: _UP4_TAAGCAGCCCGAGGATCGCT
  • BKK09958 (Δ[gene|BF6DA9F822CB6AC907E53BC8745D411245827820|sscA]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK09958 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTTACATACCTCCTTTT, downstream forward: _UP4_TAAGCAGCCCGAGGATCGCT
  • References

  • 20156992,21670523,30782632