SubtiBank SubtiBank
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.


peptide methionine sulfoxide reductase
16.46 kDa
protein length
143 aa Sequence Blast
gene length
432 bp Sequence Blast
regeneration of methionine and restoration of protein function after oxidative damage
peptide methionine sulfoxide reductase

Genomic Context



  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.8|Resistance against oxidative and electrophile stress]
  • Gene

    2,287,097 → 2,287,528

    The protein

    Catalyzed reaction/ biological activity

  • [thioredoxin]-disulfide + H2O + L-methionyl-[protein] --> [thioredoxin]-dithiol + L-methionyl-(R)-S-oxide-[protein] (according to UniProt)
  • Protein family

  • MsrB Met sulfoxide reductase family (single member, according to UniProt)
  • [SW|Domains]

  • MsrB domain (aa 5-126) (according to UniProt)
  • Structure

  • [PDB|1XM0]
  • Expression and Regulation



    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|18662407,17289755], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|2C6386E9A63F410558D168798D077DF91590F454|Spx]: activation, oxidized [protein|2C6386E9A63F410558D168798D077DF91590F454|Spx] binds [protein|5996A5C25E108A3C4562686BF34A59CB14FD56EB|RpoA] and enhances [protein|389245FDE13226D65DF117E28B5DA346DC856860|MsrA]-[protein|BF8A3C916C4B673D30AEF7C330C9BD5A487AB0EA|MsrB] operon transcription [Pubmed|18662407], in [regulon|2C6386E9A63F410558D168798D077DF91590F454|Spx regulon]
  • regulation

  • induced by oxidative stress ([protein|search|Spx])
  • view in new tab

    Biological materials


  • MGNA-A905 (yppQ::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE21680 (Δ[gene|BF8A3C916C4B673D30AEF7C330C9BD5A487AB0EA|msrB]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_TTTTTCTTCTTTATTGTACG, downstream forward: _UP4_TAAACTGTTAAAAACAGGCC
  • BKK21680 (Δ[gene|BF8A3C916C4B673D30AEF7C330C9BD5A487AB0EA|msrB]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_TTTTTCTTCTTTATTGTACG, downstream forward: _UP4_TAAACTGTTAAAAACAGGCC
  • References

  • 18662407