SubtiBank SubtiBank
The papers of the month are back! Check them out! Link here


major component of biofilm matrix, forms amyloid fibers
28.15 kDa
protein length
261 aa Sequence Blast
gene length
783 bp Sequence Blast
[SW|biofilm formation]
major component of biofilm matrix

Genomic Context



  • [category|SW 4|Lifestyles] → [category|SW 4.1|Exponential and early post-exponential lifestyles] → [category|SW 4.1.2|Biofilm formation]
  • [category|SW 4|Lifestyles] → [category|SW 4.1|Exponential and early post-exponential lifestyles] → [category|SW 4.1.2|Biofilm formation] → [category|SW|Amyloid protein synthesis, secretion and assembly]
  • [category|SW 6|Groups of genes] → [category|SW 6.12|Secreted proteins]
  • Gene

    2,553,081 → 2,553,866

    Phenotypes of a mutant

  • altered cell death pattern in colonies [Pubmed|23012477]
  • The protein

    Catalyzed reaction/ biological activity

  • forms amyloid fibers that bind cells together in the biofilm [Pubmed|20080671]
  • Protein family

  • peptidase M73 family (according to Swiss-Prot)
  • Structure

  • [PDB|5OF1] [pubmed|29531041]
  • [PDB|5OF2] [pubmed|29531041]
  • [SW|Localization]

  • extracellular (signal peptide) [Pubmed|18957862], secretion requires [protein|09B082BF39703F0D9A5980E643175DBD59F5B228|SipW] [Pubmed|10049401]
  • membrane [Pubmed|18763711]
  • Expression and Regulation



    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|16430695], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB]: repression, [PubMed|10464223,17720793], in [regulon|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB regulon]
  • [protein|5A6FBAE6553343092862CB79E150F934978C32A9|SinR]: repression, [Pubmed|16430695], in [regulon|5A6FBAE6553343092862CB79E150F934978C32A9|SinR regulon]
  • [protein|6AF1CB8998BE9C71DF4F1201A7F74FF7E75CB799|RemA]: activation, [Pubmed|23646920], in [regulon|6AF1CB8998BE9C71DF4F1201A7F74FF7E75CB799|RemA regulon]
  • [protein|E6F3BAC5875A16D8D75B2AD21447C14DD17B3DA6|LutR]: activation, [Pubmed|24196425], in [regulon|E6F3BAC5875A16D8D75B2AD21447C14DD17B3DA6|LutR regulon]
  • regulation

  • repressed by casamino acids [Pubmed|12107147]
  • additional information

  • induction by sequestration of [protein|5A6FBAE6553343092862CB79E150F934978C32A9|SinR] by [protein|24D6A7DDCB25B99FBB670E9203F826596916B35C|SinI] or [protein|C17C296F3EB2E106C380E3B5D784F3FA63F4C9B7|SlrA] [PubMed|15661000,19788541] or by SlrR [PubMed|20351052]
  • expression of the operon is localized to a ring near the periphery of the biofilm [pubmed|29590605]
  • view in new tab

    additional information

  • the mRNA is cleaved by [protein|BAB297D18F94FFA67B8D12A684AB4D1BCDFB4981|RNase III] [PubMed|26883633]
  • Biological materials


  • MGNA-C449 (yqhF::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE24620 (Δ[gene|BF97457E986656E4A9FE7A858F5BDF1759850D5C|tasA]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGGTAAGCTCCCCTTTTA, downstream forward: _UP4_TAATAACAGCAAAAAAAAGA
  • BKK24620 (Δ[gene|BF97457E986656E4A9FE7A858F5BDF1759850D5C|tasA]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGGTAAGCTCCCCTTTTA, downstream forward: _UP4_TAATAACAGCAAAAAAAAGA
  • References


  • 20735481,20351052,21488983,24988880,25907113,26418850,28783117
  • Original publications

  • 23352144,23352134,23632024,23012477,21815947,21856853,18047568,16430695,16430696,10368135,18430133,18647168,10464223,17720793,18957862,12107147,18763711,20080671,10049401,23646920,24488317,25894589,26883633,29531041,29565118,29590605