SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


major component of biofilm matrix, forms amyloid fibers
28.15 kDa
protein length
261 aa Sequence Blast
gene length
786 bp Sequence Blast
[SW|biofilm formation]
major component of biofilm matrix

Genomic Context



  • [category|SW 4|Lifestyles] → [category|SW 4.1|Exponential and early post-exponential lifestyles] → [category|SW 4.1.2|Biofilm formation]
  • [category|SW 4|Lifestyles] → [category|SW 4.1|Exponential and early post-exponential lifestyles] → [category|SW 4.1.2|Biofilm formation] → [category|SW|Amyloid protein synthesis, secretion and assembly]
  • [category|SW 6|Groups of genes] → [category|SW 6.12|Secreted proteins]
  • Gene

    2,553,081 → 2,553,866

    Phenotypes of a mutant

  • altered cell death pattern in colonies [Pubmed|23012477]
  • increases membrane fluidity and cell death [pubmed|32313019]
  • The protein

    Catalyzed reaction/ biological activity

  • forms amyloid fibers that bind cells together in the biofilm [Pubmed|20080671]
  • Protein family

  • peptidase M73 family (single member, according to UniProt)
  • Structure

  • [PDB|5OF1] [pubmed|29531041]
  • [PDB|5OF2] [pubmed|29531041]
  • [SW|Localization]

  • extracellular (signal peptide) [Pubmed|18957862], secretion requires [protein|09B082BF39703F0D9A5980E643175DBD59F5B228|SipW] [Pubmed|10049401]
  • Expression and Regulation



    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|16430695], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB]: repression, [PubMed|10464223,17720793], in [regulon|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB regulon]
  • [protein|5A6FBAE6553343092862CB79E150F934978C32A9|SinR]: repression, [Pubmed|16430695], in [regulon|5A6FBAE6553343092862CB79E150F934978C32A9|SinR regulon]
  • [protein|6AF1CB8998BE9C71DF4F1201A7F74FF7E75CB799|RemA]: activation, [Pubmed|23646920], in [regulon|6AF1CB8998BE9C71DF4F1201A7F74FF7E75CB799|RemA regulon]
  • [protein|E6F3BAC5875A16D8D75B2AD21447C14DD17B3DA6|LutR]: activation, [Pubmed|24196425], in [regulon|E6F3BAC5875A16D8D75B2AD21447C14DD17B3DA6|LutR regulon]
  • regulation

  • repressed by casamino acids [Pubmed|12107147]
  • additional information

  • induction by sequestration of [protein|5A6FBAE6553343092862CB79E150F934978C32A9|SinR] by [protein|24D6A7DDCB25B99FBB670E9203F826596916B35C|SinI] or [protein|C17C296F3EB2E106C380E3B5D784F3FA63F4C9B7|SlrA] [PubMed|15661000,19788541] or by SlrR [PubMed|20351052]
  • expression of the operon is localized to a ring near the periphery of the biofilm [pubmed|29590605]
  • view in new tab

    additional information

  • the mRNA is cleaved by [protein|BAB297D18F94FFA67B8D12A684AB4D1BCDFB4981|RNase III] [PubMed|26883633]
  • Biological materials


  • MGNA-C449 (yqhF::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE24620 (Δ[gene|BF97457E986656E4A9FE7A858F5BDF1759850D5C|tasA]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGGTAAGCTCCCCTTTTA, downstream forward: _UP4_TAATAACAGCAAAAAAAAGA
  • BKK24620 (Δ[gene|BF97457E986656E4A9FE7A858F5BDF1759850D5C|tasA]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGGTAAGCTCCCCTTTTA, downstream forward: _UP4_TAATAACAGCAAAAAAAAGA
  • References


  • 20735481,20351052,21488983,24988880,25907113,26418850,28783117,30098341
  • Original publications

  • 23352144,23352134,23632024,23012477,21815947,21856853,18047568,16430695,16430696,10368135,18430133,18647168,10464223,17720793,18957862,12107147,20080671,10049401,23646920,24488317,25894589,26883633,29531041,29565118,29590605,29802781,29887307,29921978,30297741,30833350,31370706,32313019,32430292,32491277