SubtiBank SubtiBank
tasA
The papers of the month are back! Check them out! Link here

tasA

major component of biofilm matrix, forms amyloid fibers
locus
BSU24620
pI
5.44
mw
28.15 kDa
protein length
261 aa Sequence Blast
gene length
783 bp Sequence Blast
function
[SW|biofilm formation]
product
major component of biofilm matrix
essential
no
synonyms
cotN,yqhF

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.1|Exponential and early post-exponential lifestyles] → [category|SW 4.1.2|Biofilm formation]
  • [category|SW 4|Lifestyles] → [category|SW 4.1|Exponential and early post-exponential lifestyles] → [category|SW 4.1.2|Biofilm formation] → [category|SW 4.1.2.2|Amyloid protein synthesis, secretion and assembly]
  • [category|SW 6|Groups of genes] → [category|SW 6.12|Secreted proteins]
  • Gene

    Coordinates
    2,553,081 → 2,553,866

    Phenotypes of a mutant

  • altered cell death pattern in colonies [Pubmed|23012477]
  • The protein

    Catalyzed reaction/ biological activity

  • forms amyloid fibers that bind cells together in the biofilm [Pubmed|20080671]
  • Protein family

  • peptidase M73 family (according to Swiss-Prot)
  • Structure

  • [PDB|5OF1] [pubmed|29531041]
  • [PDB|5OF2] [pubmed|29531041]
  • [SW|Localization]

  • extracellular (signal peptide) [Pubmed|18957862], secretion requires [protein|09B082BF39703F0D9A5980E643175DBD59F5B228|SipW] [Pubmed|10049401]
  • membrane [Pubmed|18763711]
  • Expression and Regulation

    Operons

    genes
    [gene|8C13E1EF5437DD8F9906643DEDCBB18DABE3B9E3|tapA]-[gene|09B082BF39703F0D9A5980E643175DBD59F5B228|sipW]-[gene|BF97457E986656E4A9FE7A858F5BDF1759850D5C|tasA]
    description
    [Pubmed|16430695]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|16430695], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB]: repression, [PubMed|10464223,17720793], in [regulon|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB regulon]
  • [protein|5A6FBAE6553343092862CB79E150F934978C32A9|SinR]: repression, [Pubmed|16430695], in [regulon|5A6FBAE6553343092862CB79E150F934978C32A9|SinR regulon]
  • [protein|6AF1CB8998BE9C71DF4F1201A7F74FF7E75CB799|RemA]: activation, [Pubmed|23646920], in [regulon|6AF1CB8998BE9C71DF4F1201A7F74FF7E75CB799|RemA regulon]
  • [protein|E6F3BAC5875A16D8D75B2AD21447C14DD17B3DA6|LutR]: activation, [Pubmed|24196425], in [regulon|E6F3BAC5875A16D8D75B2AD21447C14DD17B3DA6|LutR regulon]
  • regulation

  • repressed by casamino acids [Pubmed|12107147]
  • additional information

  • induction by sequestration of [protein|5A6FBAE6553343092862CB79E150F934978C32A9|SinR] by [protein|24D6A7DDCB25B99FBB670E9203F826596916B35C|SinI] or [protein|C17C296F3EB2E106C380E3B5D784F3FA63F4C9B7|SlrA] [PubMed|15661000,19788541] or by SlrR [PubMed|20351052]
  • expression of the operon is localized to a ring near the periphery of the biofilm [pubmed|29590605]
  • view in new tab

    additional information

  • the mRNA is cleaved by [protein|BAB297D18F94FFA67B8D12A684AB4D1BCDFB4981|RNase III] [PubMed|26883633]
  • Biological materials

    Mutant

  • MGNA-C449 (yqhF::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2447 NBRP B. subtilis, Japan]
  • BKE24620 (Δ[gene|BF97457E986656E4A9FE7A858F5BDF1759850D5C|tasA]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE24620 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGGTAAGCTCCCCTTTTA, downstream forward: _UP4_TAATAACAGCAAAAAAAAGA
  • BKK24620 (Δ[gene|BF97457E986656E4A9FE7A858F5BDF1759850D5C|tasA]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK24620 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGGTAAGCTCCCCTTTTA, downstream forward: _UP4_TAATAACAGCAAAAAAAAGA
  • References

    Reviews

  • 20735481,20351052,21488983,24988880,25907113,26418850,28783117,30098341
  • Original publications

  • 23352144,23352134,23632024,23012477,21815947,21856853,18047568,16430695,16430696,10368135,18430133,18647168,10464223,17720793,18957862,12107147,18763711,20080671,10049401,23646920,24488317,25894589,26883633,29531041,29565118,29590605,29802781,29887307,29921978,30297741