SubtiBank SubtiBank
The papers of the month are back! Check them out! Link here


transcriptional repressor of yetM and yetL, induction in response to flavonoids
19.07 kDa
protein length
167 aa Sequence Blast
gene length
501 bp Sequence Blast
regulation of yetM expression
transcription repressor (MarR family)

Genomic Context



  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW|Transcription factors/ other]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.10|Resistance against other toxic compounds (nitric oxide, phenolic acids, flavonoids, oxalate)]
  • Gene

    789,652 → 790,155

    The protein

    Effectors of protein activity

  • inducers: flavonoids of kaempferol, apigenin, and luteolin [Pubmed|19329649]
  • Expression and Regulation


    view in new tab

    Biological materials


  • MGNA-B463 (yetL::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE07220 (Δ[gene|BFAFC2CFA7F2FDA639B367C579E2A46242BA3DBD|yetL]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCGCAATTAGCTCCCGTA, downstream forward: _UP4_TAAAAAACCCGTCCGATCCG
  • BKK07220 (Δ[gene|BFAFC2CFA7F2FDA639B367C579E2A46242BA3DBD|yetL]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCGCAATTAGCTCCCGTA, downstream forward: _UP4_TAAAAAACCCGTCCGATCCG
  • References


  • 25209494
  • Original publications

  • 19329649