SubtiBank SubtiBank
yetL
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yetL

transcriptional repressor of [gene|A70EA4AEBF46ED2279E8BCE8A28439078484B6E3|yetM] and [gene|BFAFC2CFA7F2FDA639B367C579E2A46242BA3DBD|yetL], induction in response to flavonoids
locus
BSU_07220
pI
7.52
mw
19.07 kDa
protein length
167 aa Sequence Blast
gene length
504 bp Sequence Blast
function
regulation of [gene|A70EA4AEBF46ED2279E8BCE8A28439078484B6E3|yetM] expression
product
transcription repressor ([SW|MarR family])
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW 3.4.2.5|Transcription factors/ other]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.10|Resistance against other toxic compounds (nitric oxide, phenolic acids, flavonoids, oxalate)]
  • Gene

    Coordinates
    789,652 → 790,155

    The protein

    Protein family

  • [SW|MarR family]
  • Effectors of protein activity

  • inducers: flavonoids of kaempferol, apigenin, and luteolin [Pubmed|19329649]
  • Expression and Regulation

    Operons

    genes
    [gene|BFAFC2CFA7F2FDA639B367C579E2A46242BA3DBD|yetL]
    description
    [Pubmed|19329649]
    view in new tab

    Biological materials

    Mutant

  • MGNA-B463 (yetL::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1462 NBRP B. subtilis, Japan]
  • BKE07220 (Δ[gene|BFAFC2CFA7F2FDA639B367C579E2A46242BA3DBD|yetL]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE07220 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCGCAATTAGCTCCCGTA, downstream forward: _UP4_TAAAAAACCCGTCCGATCCG
  • BKK07220 (Δ[gene|BFAFC2CFA7F2FDA639B367C579E2A46242BA3DBD|yetL]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK07220 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCGCAATTAGCTCCCGTA, downstream forward: _UP4_TAAAAAACCCGTCCGATCCG
  • References

    Reviews

  • 25209494
  • Original publications

  • 19329649