SubtiBank SubtiBank
ydaF
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

ydaF

similar to acetyltransferase
locus
BSU_04210
pI
5.56
mw
20.88 kDa
protein length
183 aa Sequence Blast
gene length
552 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.1|General stress proteins (controlled by SigB)]
  • [category|SW 6|Groups of genes] → [category|SW 6.6|Poorly characterized/ putative enzymes]
  • Gene

    Coordinates
    473,174 → 473,725

    The protein

    Protein family

  • [SW|Acetyltransferase family] (according to UniProt)
  • Paralogous protein(s)

  • [protein|6072A6EF0766F3D1B1616A20CDC36CCDC6CBDA71|YjcK]
  • [SW|Domains]

  • [SW|N-acetyltransferase domain] (aa 10-176) (according to UniProt)
  • Structure

  • [PDB|1NSL] [Pubmed|15468321]
  • Expression and Regulation

    Operons

    genes
    [gene|BFDAB855DC76A78C100DC5E5FB81F73069F5F93F|ydaF]-[gene|29342783A375260C5DAE920FBF6EC6EFD2D54DDE|ydaG]
    description
    [Pubmed|22383849]
    view in new tab

    genes
    [gene|3161519994609DA9360ED6E073E4A4C8C6210EFB|ydaD]-[gene|DDE975DA2E13759B0DB8B6D219760C2E2C6032FB|ydaE]-[gene|BFDAB855DC76A78C100DC5E5FB81F73069F5F93F|ydaF]-[gene|29342783A375260C5DAE920FBF6EC6EFD2D54DDE|ydaG]
    description
    [Pubmed|10220166]

    sigma factors

  • [protein|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB]: sigma factor, [Pubmed|15805528,10220166], in [regulon|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB regulon]
  • regulation

  • induced by stress ([protein|search|SigB]) [Pubmed|15805528]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-C088 (ydaF::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2086 NBRP B. subtilis, Japan]
  • BKE04210 (Δ[gene|BFDAB855DC76A78C100DC5E5FB81F73069F5F93F|ydaF]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE04210 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTGCCTCGCCCTCTTTCC, downstream forward: _UP4_TAAAGAGCACACTTTCTTGT
  • BKK04210 (Δ[gene|BFDAB855DC76A78C100DC5E5FB81F73069F5F93F|ydaF]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK04210 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTGCCTCGCCCTCTTTCC, downstream forward: _UP4_TAAAGAGCACACTTTCTTGT
  • References

  • 10220166,18840696,15468321