SubtiBank SubtiBank
yqgT

yqgT

similar to gamma-D-glutamyl-L-diamino acid endopeptidase I
locus
BSU_24830
pI
5.91
mw
43.28 kDa
protein length
376 aa Sequence Blast
gene length
1131 bp Sequence Blast
function
cell wall metabolism
product
peptidoglycan hydrolase
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 1|Cellular processes] → [category|SW 1.1|Cell envelope and cell division] → [category|SW 1.1.3|Cell wall degradation/ turnover] → [category|SW 1.1.3.4|Endopeptidases]
  • [category|SW 1|Cellular processes] → [category|SW 1.1|Cell envelope and cell division] → [category|SW 1.1.5|Cell wall/ other]
  • Gene

    Coordinates
    2,567,360 → 2,568,490

    The protein

    Catalyzed reaction/ biological activity

  • cleaves the peptide bond between D-Glu (position 2 in the peptioglycan peptide) and m-diamino pimelic acid (position 3) [Pubmed|18266855]
  • has both endopeptidase and carboxypeptidase activities [Pubmed|18266855]
  • Protein family

  • peptidase M14 family (single member, according to UniProt)
  • [SW|Cofactors]

  • Zn
  • [SW|Localization]

  • extracellular space (according to UniProt)
  • Expression and Regulation

    Operons

    genes
    [gene|C0192CFF5259B6C9AEB995E5064C2AADF33ED4D3|yqgT]-[gene|1A070D28C3DB109F67A5E73C5F0734177995E286|yqgU]-[gene|1CC5837E19A99368962E84FC034C63F4382EE735|yqgV]
    description
    [Pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • MGNA-C480 (yqgT::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2478 NBRP B. subtilis, Japan]
  • BKE24830 (Δ[gene|C0192CFF5259B6C9AEB995E5064C2AADF33ED4D3|yqgT]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE24830 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCATCCCCCTTTTTTGTT, downstream forward: _UP4_TAACTGAAACTTTTTCTTTT
  • BKK24830 (Δ[gene|C0192CFF5259B6C9AEB995E5064C2AADF33ED4D3|yqgT]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK24830 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCATCCCCCTTTTTTGTT, downstream forward: _UP4_TAACTGAAACTTTTTCTTTT
  • References

    Reviews

  • 18266855
  • Original publications

  • 10708363