SubtiBank SubtiBank
yrdQ
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yrdQ

similar to transcriptional regulator ([SW|LysR family])
locus
BSU_26630
pI
7.26
mw
32.51 kDa
protein length
288 aa Sequence Blast
gene length
867 bp Sequence Blast
function
unknown
product
transcriptional regulator ([SW|LysR family])
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW 3.4.2.6|Transcription factor/ other/ based on similarity]
  • Gene

    Coordinates
    2,721,778 → 2,722,644

    The protein

    Protein family

  • [SW|LysR family] (according to UniProt)
  • Structure

  • [PDB|2H98] (from Acinetobacter baylyi, 23% identity)
  • Biological materials

    Mutant

  • MGNA-B510 (yrdQ::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1509 NBRP B. subtilis, Japan]
  • BKE26630 (Δ[gene|C03EB884D0ED435A2730668ABEFA83DE73A86244|yrdQ]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE26630 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGAAGATCCCCCCTTCAT, downstream forward: _UP4_TAAAGTGATTTTTCTCTTTC
  • BKK26630 (Δ[gene|C03EB884D0ED435A2730668ABEFA83DE73A86244|yrdQ]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK26630 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGAAGATCCCCCCTTCAT, downstream forward: _UP4_TAAAGTGATTTTTCTCTTTC