SubtiBank SubtiBank
cydA
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

cydA

cytochrome bd ubiquinol oxidase (subunit I), high affinity terminal oxidase
locus
BSU_38760
pI
8.94
mw
52.13 kDa
protein length
468 aa Sequence Blast
gene length
1407 bp Sequence Blast
function
respiration
product
cytochrome bd ubiquinol oxidase (subunit I), high affinity terminal oxidase
essential
no
synonyms
yxkK

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.1|Electron transport and ATP synthesis] → [category|SW 2.1.2|Respiration] → [category|SW 2.1.2.1|Terminal oxidases]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    3,977,791 → 3,979,197

    The protein

    Catalyzed reaction/ biological activity

  • 2 ubiquinol + n H+ + O2 --> 2 ubiquinone + n H+ + 2 H2O (according to UniProt)
  • Protein family

  • cytochrome ubiquinol oxidase subunit 1 family (with [protein|EB8AF295A11F28BDFAE39038FA89890824FC7791|YthA], according to UniProt)
  • Paralogous protein(s)

  • [protein|EB8AF295A11F28BDFAE39038FA89890824FC7791|YthA]
  • [SW|Cofactors]

  • heme b, heme d (according to UniProt)
  • Structure

  • [PDB|5DOQ] (from Geobacillus thermodenitrificans, 30% identity) [pubmed|27126043]
  • [SW|Localization]

  • cell membrane (according to Swiss-Prot)
  • Expression and Regulation

    Operons

    genes
    [gene|C0459C0D45E31561D281E016D86CD80DCAF13357|cydA]-[gene|E66EAB3C172ED8D1D26C675A7338B8153FB66987|cydB]-[gene|A65576E0261F1950A0DAD72B2432D97AB3EB2AA5|cydC]-[gene|244BF9E397FDB0691FFAA8C9D419B0AE417CACE1|cydD]
    description
    [Pubmed|16207915]

    sigma factors

  • [protein|CFF318EE6CACDEE763FBF96A2ABB46E944679AAA|SigF]: sigma factor, [PubMed|16497325], in [regulon|CFF318EE6CACDEE763FBF96A2ABB46E944679AAA|SigF regulon]
  • regulatory mechanism

  • [protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA]: repression, in [regulon|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA regulon]
  • [protein|B5EF521437323EF43F08E5EFDB5C798616CA499A|Rex]: repression, [Pubmed|15231791], in [regulon|B5EF521437323EF43F08E5EFDB5C798616CA499A|Rex regulon]
  • [protein|1E829D639BADDC6BDC9B5FB4C97A632A53FDDB24|ResD]: activation, [Pubmed|17322317], in [regulon|1E829D639BADDC6BDC9B5FB4C97A632A53FDDB24|ResD regulon]
  • regulation

  • expressed under anaerobic conditions ([protein|search|ResD]) [Pubmed|17322317]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-B745 (cydA::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1744 NBRP B. subtilis, Japan]
  • BKE38760 (Δ[gene|C0459C0D45E31561D281E016D86CD80DCAF13357|cydA]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE38760 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGCTTTCTCCTCCATTTC, downstream forward: _UP4_GATCCATTTAGTCAGGAGGT
  • BKK38760 (Δ[gene|C0459C0D45E31561D281E016D86CD80DCAF13357|cydA]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK38760 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGCTTTCTCCTCCATTTC, downstream forward: _UP4_GATCCATTTAGTCAGGAGGT
  • References

  • 16207915,17322317,17015645,15231791,9852001,10551842,15231791,17322317,27126043