SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


putative anti-[protein|801E92306971E26AD4AB155172B7F4EFDE2F9170|SigY] protein
11.86 kDa
protein length
106 aa Sequence Blast
gene length
321 bp Sequence Blast
control of [protein|801E92306971E26AD4AB155172B7F4EFDE2F9170|SigY] activity
putative anti-[protein|801E92306971E26AD4AB155172B7F4EFDE2F9170|SigY] protein

Genomic Context



  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.1|Sigma factors and their control] → [category|SW|Control of sigma factors]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.2|Cell envelope stress proteins (controlled by SigM, V, W, X, Y)]
  • [category|SW 6|Groups of genes] → [category|SW 6.1|Essential genes]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    3,969,999 → 3,970,319

    Phenotypes of a mutant

  • essential [Pubmed|22400495]
  • The protein


  • cell membrane (according to UniProt)
  • Expression and Regulation



    sigma factors

  • [protein|801E92306971E26AD4AB155172B7F4EFDE2F9170|SigY]: sigma factor, [Pubmed|12897008], in [regulon|801E92306971E26AD4AB155172B7F4EFDE2F9170|SigY regulon]
  • view in new tab

    Biological materials


  • MGNA-B758 (yxlC::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE38690 (Δ[gene|C07156CBA0AA3BAB24D17D15708FC68E74A854A7|yxlC]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CTTTAAATGATCAGAAAGCT, downstream forward: _UP4_GGCGAATGCGAGGTGAAACG
  • BKK38690 (Δ[gene|C07156CBA0AA3BAB24D17D15708FC68E74A854A7|yxlC]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CTTTAAATGATCAGAAAGCT, downstream forward: _UP4_GGCGAATGCGAGGTGAAACG
  • References

  • 14993308,12897008,14769884,22400495