SubtiBank SubtiBank
yvaK [2019-08-09 12:24:39]
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.

yvaK [2019-08-09 12:24:39]

general stress protein, carboxylesterase
28.26 kDa
protein length
248 aa Sequence Blast
gene length
747 bp Sequence Blast

Genomic Context



  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.1|General stress proteins (controlled by SigB)]
  • [category|SW 6|Groups of genes] → [category|SW 6.6|Poorly characterized/ putative enzymes]
  • Gene

    3,454,221 → 3,454,967

    The protein

    Catalyzed reaction/ biological activity

  • A carboxylic ester + H2O = an alcohol + a carboxylate (according to Swiss-Prot)
  • Protein family

  • lipase/esterase LIP3/BchO family (single member, according to UniProt)
  • Structure

  • [PDB|1TQH] (Geobacillus stearothermophilus)
  • Expression and Regulation



    sigma factors

  • [protein|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB]: sigma factor, [Pubmed|11544224], in [regulon|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB regulon]
  • regulation

  • ''[protein|search|yvaK]'': induced by stress ([protein|search|SigB]) [Pubmed|11544224]
  • view in new tab



  • ''[protein|search|yvaK]'': induced by stress ([protein|search|SigB]) [Pubmed|11544224]
  • view in new tab

    Biological materials


  • MGNA-B606 (yvaK::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE33620 (Δ[gene|C0B6520E74CE9F7EE3DEC8C0D83E0770F241C4E8|yvaK]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGCTCATGTCTCCCTTTC, downstream forward: _UP4_TGGTAATCAACAGGAGGTCG
  • BKK33620 (Δ[gene|C0B6520E74CE9F7EE3DEC8C0D83E0770F241C4E8|yvaK]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGCTCATGTCTCCCTTTC, downstream forward: _UP4_TGGTAATCAACAGGAGGTCG
  • References

  • 11544224,17369301,23812333